Sequence Analysis of M2 Gene of Avian Influenza Virus Strain (A/Chicken/Iran/101/98 (H9N2)) as an Oil Vaccine Seed

Document Type: Short Paper

Authors

1 Department of Biotechnology, Razi vaccine and serum research Institute, P.O. Box 31975/148, Karaj, Ira and Department of Avian Medicine, School of Veterinary Medicine, Shiraz University, P.O. Box 1731, Shiraz, Iran

2 Department of Biotechnology, Razi vaccine and serum research Institute, P.O. Box 31975/148, Karaj, Iran

3 Department of Avian Medicine, School of Veterinary Medicine, Shiraz University, P.O. Box 1731, Shiraz, Iran

Abstract

In this study, the full-length M2 gene of the avian influenza virus (H9N2) was isolated, analyzed and studied in detail. Total RNA was extracted and cDNA of the M2 mRNA was obtained by reverse transcriptase polymerase chain reaction (RT-PCR) using random hexamer oligoes; specific primers were used for amplification of the M2 open reading frame (ORF) region. PCR was able to amplify the desirable fragment (294-bp) of the spliced M2 gene. The nucleotide sequence homology between the Iranian isolate and other H9 and H5 subtypes of influenza A from different hosts and geographical areas deposited in GenBank ranged from 92 to 98% and the amino acid sequence homology ranged from  97 to 100%.

Keywords


Influenza A virus expresses two highly immunogenic, but variable, transmembrane proteins; hemagglutinin (HA) and Neuraminidase (NA) which constantly evolve by the mechanisms of antigenic drift and antigenic shift (Webster et al., 1992). Another transmembrane protein of the influenza A virus is an M2 integral membrane protein. A large number of M2 molecules are expressed at the plasma membrane of the influenza virus-infected cell surface, with a ratio of approximately two M2 molecules per HA (Zebedee et al., 1988). The 97-amino acid M2 protein is a homotetrameric integral membrane protein that exhibits ion channel activity and is composed of 24 extracellular amino acids, 19 transmembrane amino acids, and 54 cytoplasmic residues (Bauer et al., 1999; Holsinger et al., 1991; Lamb et al., 1985). Disulfide bonds link the protein through cysteines located in the extracellular region (Holsinger et al., 1991); the protein (ion channel) is the target of antiviral drugs like amantadine and remantadine. The ion channel activity of M2 is important both during virion uncoating and during viral budding. Certain mutations in the M2 gene lead to viruses that are resistant to antiviral drugs (Pinto et al., 1992; Hay et al., 1985).
     In recent years scientists have focused on the influenza M2 protein as a candidate for a universal vaccine. The present study involved the analysis of the M2 open reading frame (ORF) of the A/chicken/Iran/101/1998 avian influenza (H9N2) isolate using as an inactivated vaccine seed from the Razi Vaccine and Serum Research Institute in order to evaluate the homology level between this isolate and others deposited in GenBank.
 For this purpose the avian influenza A/chicken/Iran/101/1998 (H9N2) used as a vaccinal seed in the Marand branch of Iran’s Razi Institute was grown in primary chicken embryo cell cultures and cells were maintained in a humidified air-5% CO2 atmosphere at 37ºC. Then the Influenza virus infected cells were then collected after 18 h of incubation by centrifugation at 3000 ×g for 10 min following cell culture tripsinization.
      Total RNA was extracted by the guanidinium isothiocyanate method using RNX-Plus™ (Cinagen, Tehran, Iran) solution. The extracted total RNA was then dissolved in 20 ml of RNase-free water. To clone full-length spliced M2 mRNA in cell culture, two gene-specific primers (M2U and M2L) were designed, the gene specific sequences were selected by comparison and alignment of the M2 gene sequences retrieved from the GenBank database by DNAMAN (version 4.13) and Oligo (version 5) software. The designed primers sequences are as follows: M2U (Forward): 5´GGAATTCCATATGAGTCTTCTAACCGAG3´ and the M2L (Reverse): 5´GGAATTCCTTACTCCAGCTCTATGTTG 3´.
     After RNA extraction, cDNA synthesis was prepared by the AMV first strand cDNA synthesis kit (Mannheim, Roche, Germany) using random hexamer oligoes, according to the manufacture’s protocol. The cDNA was then amplified using specific primers (M2U and M2L) resulting in a 310 bp fragment of the spliced M2 gene containing restriction enzymes site sequences.
     Polymerase chain reaction (PCR) was performed in a 50 ml mixture containing 5 ml of 10X reaction buffer with MgSO4 (2mM), 4 ml of mixed dNTPs (2.5 mM each), 1 ml of each specific primer (10 pmol each), 0.5 ml of pfu DNA polymerase (2.5 u/ml) (Mannheim, Roche, Germany), 3 ml of cDNA template, and 35.5 ml of DEPC water. The PCR program involved denaturation at 95ºC for 3 min, followed by 5 cycles of denaturation at 95ºC for 1 min, annealing at 54ºC for 1 min, extension at 72ºC for 1 min, and then 30 cycles of denaturation at 95°C for 1 min, annealing at 56ºC for 1 min, extension at 72ºC for 1 min, followed by a final extension at 72ºC for 10 min. The resulting PCR products were then analyzed by 1.5% (w/v) agarose gel electrophoresis. The PCR products were subsequently run on a 1% (w/v) agarose gel and the distinct band was purified using PCR product purification kit (Mannheim, Roche, Germany), according to manufacture protocol. The resulting purified product was sequenced by the MWG Biotech Co. (Germany). All sequence data were identified by Blast search in the NCBI database and compared with registered avian influenza isolates in GenBank.
      The PCR technique was able to amplify two distinct bands, the desirable fragment (310 bp) of the spliced M2 gene ORF containing restriction enzymes site sequences and the fragment (1000 pb) of the segment 7 gene belonging to the  A/chicken/ Iran/101/1998 (H9N2) (Fig. 1). The nucleotide sequence homology between the Iranian isolate and the other GenBank deposited isolates of influenza A viruses from different hosts and geographical areas ranged from 87% to 98% (data not shown). The maximum M2 gene homology was observed between the Iranian isolate and the H9 and H5 isolates from Dubai, Pakistan, and Hong Kong states (Fig. 2).
      To perform a direct comparison between the Iranian M2 extracellular domain and those of the other isolates deposited in GenBank, the amino acid sequences of all isolates were compared with that of the A/chicken/Iran/101/1998 (H9N2) representing as a baseline sequence. The amino acid sequence homologies ranged from 92% to 100% among all H5 and H9 isolates of influenza A obtained from different hosts and geographical areas (Fig. 3).
     The nucleotide sequence of the Iranian M2 gene isolate diverged by 2% from the most closely related viruses in GenBank. At the nucleotide level based on the M2 gene, the Iranian isolate was more closely related to its neighboring states, such as Dubai and Pakistan. A similar relationship could be seen between the Iranian isolate and the Hong Kong H9 and H5 isolates, exhibiting nucleotide sequence differences of approximately 2% and amino acid sequence homology of 100%. Nucleotides similarities observed between the H5 and H9 isolates were more than other isolates that were derived from hosts located in different areas. The N-terminal domain of the influenza A M2 protein is the major part of this immunogenic protein (Neirynck et al., 1999). Hence, in this study the M2 open reading frame was translated and the region between amino acids position 1 and 24 of the M2 protein was analyzed. Sequence alignment based on the amino acid sequences of the M2 protein exhibited less diversity than the nucleotide-based sequence alignments. The 100% homology level between the N-terminal domain of the H5 and H9 isolates was considerable. Those which did not show 100% homology only possessed substitution of 1 and rarely 2 residues within residue 10 and 16 over a span of 24 residues. These changes are consistent with those described in previous reports (Widjaja et al., 2004).
 Meanwhile, comparisons of the amino acid sequences of the M2 protein belonging to the Iranian H9N2 isolate with all other isolates of influenza A deposited in GenBank, indicated that the gene and amino acid sequences between all H9 and H5 isolates are more closely related than others. In this study, from the alignment of the M2 gene and comparison of amino acids, it was not possible to find an M2 gene or amino acid substitution that was a host or region-related substitution. They tend to vary more between species than within them and do not appear to change progressively over time, such as the surface glycoprotiens.
Acknowledgments

This project was financially supported by a grant from the Razi Vaccine and Serum Research Institute (No. 2-18-18-86007). The authors wish to thank Dr. H. Paykari, Dr. M. Esmailzade, Dr. A. Mirjalili and Dr. S.M. Mirafzali, faculty members at the Razi Vaccine and Serum Research Institute, for their helpful contributions to this project.

 

Bauer CM, Pinto LH, Cross TA, Lamb RA (1999).The influenza virus M2 ion channel protein: probing the structure of the transmembrane domain in intact cells by using engineered disulfide cross-linking. Virology 254: 196-209.
Hay AJ, Wolstenholme AJ, Skehel JJ, Smith MH (1985). The molecular basis of the specific anti-influena action of amantadine. EMBO J. 4: 3021-3024.
Holsinger LJ, Lamb RA (1991). Influenza virus M2 integral membrane protein is a homotetramer stabilized by formation of disulfide bonds. Virology 183: 32-43.
Lamb RA, Zebedee SL, Richardson CD (1985). Influenza virus M2 protein is an integral membrane protein expressed on the infected-cell surface. Cell 40: 627-633.
  Neirynck S, Deroo T, Saelens X, Vanlandschoot P, Jou WM, Fiers W (1999). A universal influenza A vaccine based on the extracellular domain of the M2 protein. Nat Med.  5: 1157-1163.
Pinto LH, Holsinger IJ, Lamb RA. (1992). Influenza virus M2 protein has ion channel activity. Cell 69: 517-528.
Webster RG, Bean WJ, Gorman OT, Chambers TM, Kawaoka Y (1992). Evolution and ecology of influenza A viruses. Microbiol Rev. 56: 152-179.
Widjaja L, Krauss SL, Webby RJ, Xie T, Webster RG (2004). Matrix gene of influenza A viruses isolated from wild aquatic birds: Ecology and emergence of influenza A virus. Virology 78: 8771-8779.
Zebedee SL, Lamb RA (1988). Influenza A virus M2 protein: monoclonal antibody restriction of virus growth and detection of M2 in virions. Virology 62: 2762-2767.