1. Background
Biological nitrogen fixation (BNF) refers to the process in which atmospheric N (N2) is reduced to ammonia (NH3) molecule ( 1 ). BNF has been classified into rhizobium-legume symbiotic nitrogen (N) fixation, associative N fixation (ANF), and autogenous N fixation system. To reduce the application of chemical fertilizers and environmental pollution, BNF has received high attention ( 2 ) recently. Various of endophytes associative N fixation bacteria have been reported to promote sugarcane growth, which are identified to be a valuable source of nitrogen for sustainable crop production as well as to maintain soil fertility ( 3 ).
N-fixing microorganisms have shown diversity in different environments. The diazotroph observations are often characterized in terms of measured in-situ abundance of the nifH gene, which is an essential gene in nitrogen fixation, encoding a structural component of the nitrogenase enzyme ( 4 - 5 ). The reduction of dinitrogen by Mo-dependent nitrogenase passes through the transient interaction of two-component proteins known as Fe protein and MoFe protein under the two-component regulatory system. Fe-protein has two identical subunits connected via the 4Fe-4S cluster and a γ2-dimer composed of identical subunits encoded by nifH ( 6 ). Nitrogen fixation genes expression in foreign hosts such as Escherichia coli and yeast was achieved in 1985 ( 7 ). Klebsiella spp. is one of the N-fixing species isolated from sugarcane, and some studies have reported the NifH protein exists in Klebsiella pneumoniae ( 8 ). However, the nifH gene in Klebsiella variicola, a novel species associated with plant ( 9 - 10 ), is less reported.
Klebsiella variicola DX120E is an endophytic BNF bacteria isolated from the roots of sugarcane, which has a wide range of characteristics, including N fixation, solubilization of mineral phosphates, production of siderophore, secretion of growth hormone, with positive effects on sugarcane growth. 15N isotope dilution assay has proven that DX120E strain successfully fixed N2 in the sugarcane variety ROC22 ( 11 ), but the mechanism of the interactions between sugarcane and this microorganism remains unknown.
2. Objectives
The objective of the current study was to characterize the fuction of the DX120E nifH gene in Klebsiella variicola through gene editing (CRISPR-Cas system) and assess the nitrogen fixation capacity regulated by Fe protein antibodies in the microbe-sugarcane system.
3. Materials and Methods
3.1. Molecular Cloning of NifH and Prokaryotic Expression
Klebsiella variicola DX120E, preserved in glycerol at -80 °C, was inoculated on LB solid media after gradient dilution and cultured overnight at 28 °C. The nifH gene was cloned into vector pMD18-T (Takara, Japan) and transformed into E. coli DH5α cells. Positive plasmids were sequenced using sanger sequencing technology by Qingke Biotechnology Co., Ltd. Guangzhou, China. The sequence data were compared with the NCBI database’s open reading frame (ORF) of the nifH gene (GenBank: KF732646.1). The pMD18-T-nifH and pET-30a vector were digested with EcoRI and Not I restriction enzymes (Takara, Japan) by incubating at 37 °C overnight, and the target DNA fragments were purified. The T4 DNA ligase (Takara, Japan) was used to ligate the target fragments to express in the vector. The plasmid pET-30a-nifH was re-extracted and transformed into E. coli BL21 (DE3) cells for protein expression. All the samples were electrophoretically separated (50 V, 30 min; 120 V, 2.5 h) by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with 12.5% separation gel and 5% stacking gel ( 12 ).
3.2. Antibody Production
According to the 1:5 (v/v) ratio of the original bacterial solution, precooled bacterial lysis buffers (50 mM Tris-HCl (pH 8.5 to 9.0), 2 mM EDTA, 100 mM NaCl, 0.5% Triton X-100, 1 mg.mL-1 lysozyme) were added and the resuspended bacteria were broken by sonication in an ice bath. Subsequently, the pellet was washed with 2 M and 4 M urea containing 1% Triton X-100 and dissolved in 8 M urea. The recombinant protein was identified by SDS-PAGE ( 12 ) .
Two Japanese white rabbits were used in the immuni-zation experiment. On the first day, these rabbits were immunized with 0.3 mg of recombinant protein immunogenic and sterile Freund’s complete adjuvant (Freund’s incomplete adjuvant and Mycobacterium tuberculosis) by subcutaneous multi-point injection. On the 12th, 26th, and 40th days, the rabbits were immunized with 0.15 mg recombinant protein and Freund’s incomplete adjuvant (lanolin: mineral oil = 1: 1.5). The inoculated rabbits were kept in good conditions during the experiment, and blood samples were collected on the 52th day. The antisera were obtained by centrifugation, and indirect ELISA was used to test the titer of the antisera at indicated time points. The antigen was adhered to the solid phase carrier by coupling sulfolink coupling gel with prepared immunogen sulfhydryl, and the antibody was obtained through affinity purification. The final concentration of the antibodies was measured after repacking in an aseptic EP tube.
3.3. Construction of NifH Mutants and Replenishment Strains
PCR reaction was conducted using the strain DX120E genomic DNA as a template along with nifH up-F/nifH up-R, nifH-down-F/nifH down-R, nifH-MCS-F/nifH-MCS-R primers, respectively, to amplify up/down homologous fragments of nifH gene, and the plasmid pBBR1MCS2 was amplified in PCR by using the primers MCS-nifH-F/MCS-nifH-R. The PCR amplified products of nifH up and down fragments were purified and subjected to fusion PCR in a total volume of 50 μL comprising of 25 μL 2×Superpfu PCR mixture, 2 μL nifH-UP-F (10 μM), 2 μL nifH down-R (10 μM), 4 μL up recovery fragment, 4 μL down recovery fragment, and 13 μL ddH2O. The PCR parameters were set as 94 °C 5 min, 32 cycles (94 °C 30 s, 50 °C 30 s, 72 °C 30 s), and 10 °C hold on. The fused UD fragments with A were ligated to the T vector and sequenced. The prepared knockouted plasmid (pKLCas9Tc-UP-down) and repair homology arm fragments (pBBR1MCS2-Tac-nifH) were electro-transformed into strain DX120E to obtain positive clones through screening. The correctly sequenced positive plasmid was transformed into strain DX120E, and finally, the mutant strain ΔnifH and C (ΔnifH) were obtained.
3.4. Analysis of Biological Characteristics of NifH mutants
3.4.1. Determination of Growth Curve and Nitro-genase Activity
The strain DX120E, ΔnifH, and C (ΔnifH) were inoculated into LB medium and put for shaking culture at 28 °C. Samples were taken every 4 h to measure the OD600. An acetylene reduction assay was used to determine the nitrogenase activity ( 13 ).
3.4.2. Bacterial RNA Extraction and RT-QPCR
Trizol (Solarbio, China) ( 14 ) was used to extract the bacterial RNA. Snap frozen tissues were ground in liquid nitrogen using a mortar and pestle. One milliliter of Trizol per to 50-100 mg of tissue was added. The samples were solubilized for 5 min at room temperature, 0.2 mL of chloroform per mL of Trizolwas added, mixed vigorously by vortex for 30 sec and the mixture was allowed to stand for 2-3 min at room temperature. The mixture was centrifuged at maximum speed of 12,000 ×g for 10 min at 4 °C, and the clear upper phase was transferred to a fresh tube (0.5-0.6 mL). Then 0.5 mL of isopropanol was added per milliliter of the clear phase, and mixed vigorously by vortexing for 10 min. After centrifuging at 12,000 ×g for 10 min at 4 °C, the supernatant was decanted and precipitated, the obtained RNA was dried with a pulled Pasteur pipette, then the RNA precipitate was washed with the mixture of ethanol and Trizol (1:1). After re-centrifuged at 12,000 ×g for 2 min at 4 °C, the liquid was discarded. The pellet was allowed to dry upside down at room temperature for 5 to 10 min. An appropriate amount of DEPC-treated water was added to dissolve the RNA precipitate. The RNA concentration at OD260 was measured by IMPLEN (NanoPhotometer® P-ClassP 300). RT-qPCR was conducted using HiScript® III 1st Strand cDNA Synthesis Kit (+gDNA wiper) and ChamQ SYBR Color qPCR Master Mix (High ROX Premixed) (Vazyme Biotech Co., Ltd, China). The reference 16S RNA and target gene primers were shown in Table 1. The 2-△△Ct method ( 15 ) was used for expression analysis.
Name | Sequence (5´⟶3´) | Annealing temperature |
---|---|---|
nifH-UP-F | TAGCGGCCCA TTCA TCGACA | 55℃ |
nifH-UP-R | TGGTGAGGATCCTGTGCGGTGACTTCTCCTGTTGTTGA | |
nifH-down-F | AACAGGAGAAGTCACCGCACAGGATCCTCACCATGACCAA | 55℃ |
nifH-down-R | CCGGTTTA TCCAGCGCCTTG | |
nifH-ter-F | ATGACCATGCGTCAATGCGCTA | 58℃ |
nifH-ter-R | TCAGGCCGCGTTTTCTTCAG | |
nifH sgRNA | A TGCGTCAA TGCGCTA TCTA | |
nifH-MCS-F | ATATACCATGGAAGCTTACATGACCATGCGTCAATGCGCTA | 55℃ |
nifH-MCS-R | CGGTATCGATCTCGAGTCAGGCCGCGTTTTCTTCAG | |
MCS-nifH-F | AAGAAAACGCGGCCTGACTCGAGATCGATACCGTCGA | 55℃ |
MCS-nifH-R | TGACGCATGGTCATGTAAGCTTCCATGGTATATCTCCTTCTT | |
MCS2-JD-F | ACACTGCTTCCGGTAGTCAA | 55℃ |
M13R | AGCGGATAACAATTTCACACAGG | |
16SF | CTGGAACTGAGACACGGTCC | 55℃ |
16SR | GGAGTTAGCCGGTGCTTCTT | |
nifDF | CCGACCAAAATCGCCGAATC | 55℃ |
nifDR | CGCCATCTGCCCCTCATATT | |
nifKF | AGCTTTATCGGCAGCCATGT | 55℃ |
nifKR | CCGGTCACCAGATTGAGCTT | |
nifHF | GACGAACTGATCATCGCCCT | 55℃ |
nifHR | GGTCGTACTCGATCACCGTC |
3.4.3. Extraction of Protein and Western Blotting Analysis
Sugarcane plantlets (ROC22) were cultured and kept in the Guangxi Key Laboratory of Sugarcane Biology at Guangxi University. 200 single sugarcane plantlets were planted in 50 bottles, and each bottle had 4 plantlets and 25 mL (1/10 MS) liquid medium. In the treatment group, 25 bottles of culture medium were inoculated with 100 μL of bacterial suspension, and in the control group, each bottle was inoculated with an equal volume of sterile water. Samples were collected on the 0, 3rd, and 6th days of culturing and maintained in a sterile environment during the experiment. The phenol extraction method was used to extract the total protein from the samples ( 16 ).
A 50 mL volume of bacterial suspension was centri-fuged at 8000 × g (4 °C) for 5 min, and the pellet was washed and dissolved in 1 mL of lysis buffer. The total plant protein, induced recombinant protein and bacterial protein were denatured at 100 °C for 5 min and separated by SDS-PAGE ( 12 ). Western blotting was conducted according to Taylor and Posch ( 17 ).
4. Results
4.1. Molecular Cloning and Bacterial Expression
The 882 bp nifH gene was obtained in the PCR reaction using strain DX120E genomic DNA as the template. The bacterial colonies were easily screened by white (recombinant) and blue (non-recombinant) colors. The plasmid of the bacterial strain with the pET-30a-nifH sequence was extracted and sequenced through sanger sequencing. The results were consistent with the known ORF of the nifH gene (GenBank: KF732646.1) ( 18 ). Double digestion of the plasmid was done with the restriction enzymes EcoRI and NotI to divide the pET-30a nifH vector into two parts with sizes of 5392 bp and 889 bp, respectively. These results showed that the full-length nifH gene was cloned successfully into the pET-30a (+) vector, and the prokaryotic expression vector pET-30a-nifH was effectively constructed (Fig. 1A, 1B). The pET-30a-nifH was transferred into E. coli BL21 (DE3) and positive colonies were used to construct a prokaryotic expression system (nifH-ORF).
The recombinant pET-30a-NifH protein was success-fully expressed in a prokaryotic expression system (Fig. 2A). The positive strains were cultured at 37 °C in IPTG with a final concentration of 0.5 mM for different lengths of time. The NifH protein band of 43 kDa could be seen starting at 2 h post-induction. The full expression content was induced at 6 h (Fig. 2B). Finally, 0.5 mM IPTG and 6 h culture time were selected for induction culture according to the experiment’s protocol. The induced protein was precipitated mainly by ultrasonic treatment (Fig. 2C), indicating that the recombinant protein of pET30a-nifH was mainly in the form of an inclusion body in this expression system. The amounts of induced proteins identified through Western blotting were 5 ng and 10 ng in response to the mouse anti-His tag antibody. A distinct band of 43 kDa in size was discovered in Western blotting (Fig. 2D).
4.2. Antibody Production
SDS-PAGE showed that the inclusion body protein bands were clear. Immunogen concentration was 6 µg·mL-1, suitable for immune conditions (Fig. 3A). The antisera were tested by indirect ELISA, and the result showed that the titer of antisera reached 1:512000 (Fig. 3B). To reduce the influence of background noise in Western blotting, the antisera affinity was purified using the specific antigen-antibody, and the final concentration of the antibody was 2.51 µg. mL-1.
4.3. Western Blotting Analysis of Immunogen and Endogenous NifH Proteins
It is considered that the polyclonal antibodies of the NifH protein could confidently recognize the recombinant protein. The amounts of identified induced protein through Western blotting were 5 ng and 10 ng, respectively, in response to the anti-NifH antibody in rabbits. A distinct band of 43 kDa in size was discovered in Western blotting. At the same time, the total protein from Klebsiella variicola DX120E was detected by Western blotting with our anti-NifH antibody, and the protein band was visible (Fig. 3C). These results verified that the rabbit polyclonal antibody could recognize both the exogenous and endogenous NifH proteins.
4.4. NifH Protein Expression Analysis of Tissue Cultured Sugarcane Seedlings
Tissue cultured seedlings of sugarcane variety ROC22 and Klebsiella variicola DX120E were co-cultured for 0, 3, and 6 days, and total protein was extracted by the phenol extraction method. The expression of ROC22 NifH protein in the seedlings was found to be higher at 6th day (0.31) than that at 0 day (0.24) determined by Western blotting (Fig. 3D). It confirmed that the antibody could detect protein expression. Moreover, N-fixing strains could enter sugarcane seedlings from the inoculation site and migrate into the aboveground part.
4.5. Effects of NifH Gene Deletion on N-Fixing Bacteria
4.5.1. Screening of Mutant Strains
The nifH-UP-F/nifH-UP-R and nifH-down-F/nifH-down-R were used to amplify the upstream and downstream homology arms of nifH, respectively (Fig. 4A), and the 1096 bp fusion fragments of the upstream and downstream arms were obtained by fusion PCR (Fig. 4B). The knockouted plasmid was electroporated, and the homology arm fragment was repaired, so the knockouted strain △nifH was identified (Fig. 4C, 4D). At the same time, the MCS-nifH replenishment plasmid was constructed to transform the knockouted strain to obtain the knockout replenishment strain C (ΔnifH) (Fig. 4E,4F). The above strains were used in the following physiological and biochemical experiments.
4.5.2. Effects on Growth
Growth curve analysis showed no significant varia-tion among wild-type strains, mutant strains, and com-plementary strains of strain DX120E in LB medium at 37 °C, and all the strains showed maximum growth rate at 16 h and later started gradual decline (Fig. 5A).
4.5.3. Effect of NifH Mutation on Nitrogenase Activity
The acetylene reduction method was applied to detect nitrogenase activity in wild-type strain DX120E, nifH mutant strains, and replenishment strains during the N fixation process. It was found that mutation of the nifH gene decreased the nitrogenase activity of the strain. However, the replenishment strain restored the N-fixing ability which was significantly higher than that in the wild-type strain, which suggested that mutation of the nifH gene had lowered the strain’s N-fixing capability (Fig. 5B).
4.5.4. Effect of NifH Mutation on NifD and NifK Genes
NifD and nifK are the critical nitrogenase genes, and their relative expression levels were determined in the three bacterial strains by RT-qPCR. Significant variations were observed among the expression levels of nifK and nifD genes in wild-type, knockouted, and complementary strains. Relative expression of nifD and nifK genes were significantly higher in wild-type than mutant and complementary strains (Fig. 5C).
4.5.5. Effects of NifH Gene Knockout on NifH Protein Expression
The Western blotting technique identified the effects of nifH gene knockout on NifH protein expression in the three strains of N-fixing bacteria. The result displayed that mutation of the nifH gene downregulated the expression of NifH protein in the strains. A comparison of NifH protein expression among these three strains showed that the expression level was higher in the complementary strain than the wild-type and knockouted strains (Fig. 5D).
5. Discussion
The sugarcane microbiome consists of diverse plant growth-promoting microorganisms, including N-fixing bacteria (diazotrophs). A survey conducted in the sugarcane area of Guangxi, China, found the Enterobacteriaceae family, especially Klebsiella, is the most abundant plant-associated N-fixing bacteria ( 19 ). Klebsiella variicola, an N-fixing strain, is a member of the same family and colonizes sugarcane, promoting plant growth and has the potential to replace chemical fertilizer partially ( 10 ). Extensive analysis of N-fixing genes has served as a base for developing molecular assays and bioinformatic methods to explore N fixation in the environment ( 20 ). Nitrogen fixation is carried by an enzyme complex called nitrogenase which consists of two main components: a dinitrogenase encoded by nifD and nifK and an iron-containing reductase, also called Fe protein which is encoded by nifH. However, the specific function of the nifH gene in the nitrogen-fixing bacterium DX120E and its application in assessment of nitrogen fixation capacity in microbial and sugarcane systems have not been systematically investigated.
In addition to the acetylene reduction method, biological N fixation could also be assessed through the nitrogen-fixing enzyme’s expression by antibodies, and NifH is one of the most detected proteins ( 21 , 22 ). In the current study, the expression of NifH protein was determined using a polyclonal antibody prepared in this experiment, and enhanced NifH protein expression was noticed in sugarcane seedlings co-cultured with Klebsiella variicola DX120E for 3 days. N-fixing microorganisms contain dinitrogenase, one of the subunits encoded by nifH. Detection of nifH gene expression indicated the presence of N-fixing bacteria and N-fixation in plants. However, after 3 days, the expression level of NifH protein decreased. A possible reason for the reduction in the expression of NifH protein may be the gradual consumption of nutrients in the culture medium, which led to the nutritional competition between DX120E and plants. But this assumption needs further investigation. Li, et al. ( 23 ) reported an upregulation of nifH in the pre-inoculation period and a downregulation later. NifH proteins were also detected in control, which could be linked with the presence of endosymbiotic bacterial colonies in plants ( 24 ).
Gavini and Burgess ( 25 ) have shown that the nifHDK genes are transcribed as a single unit in many microorganisms, hence the mutant strains cannot synthesize the nifH polypeptide and FeMo cofactor. The absence of NifH protein, a central nitrogenase component, causes a reduction in N fixation capacity ( 26 ). In the nifH knockouted strain, the nifD and nifK gene transcript copies and nitrogenase activity decreased. Western blotting analysis showed a decrease in the content of Fe protein in the nifH knockouted strain and an improvement in the complementled strain. This result matched well with previous research that found the wild-type strain Acetobacter diazotrophicus PAL5 grew better and the plants inoculated with the wild-type strain accumulated more nitrogen with a lower δ15N signature after 60 days than the plants inoculated with nifH-mutant ( 27 ). Enhanced expression of NifH protein was found in the replenishment strain, which might be due to the overexpression of the nifH gene in response to solid plasmid motion ( 28 ).
To our knowledge, Klebsiella variicola is a well-known species that contains diazotrophs. In the present study, one of the N-fixing enzyme genes, nifH has been cloned and expressed in E. coli BL21 (DE3). A polyclonal antibody prepared by immunizing rabbits with nifH protein was used to successfully detect the expression of endogenous and exogenous Fe proteins, which lay the foundation for assessing the nitrogen-fixing capacity of nitrogen-fixing bacteria by enzyme-linked immunity. Moreover, the nifH gene knockouted mutant of DX120E showed lower nitrogen fixation capacity in strains and microbial sugarcane systems.
6. Conclusion
Using the rabbit polyclonal antibody proved that the core fraction of N-fixing enzymes, Fe protein, is presented in nitrogen-fixing bacteria and endophytic microbial and sugarcane systems. The nifH deletion limited the nitrogen fixation enzyme activity of DX120E and reduced the expression levels of the nitrogen fixation-related genes nifD, nifK and Fe protein at molecular level. Although the immunological and CRISPR-Cas9 system gene editing approaches have laid the foundation for studying other nitrogen-fixing genes, the interaction mechanism between N-fixing genes and plants still needs exploration. So, it is emphasized to develop comprehensive strategies to use N-fixing bacteria to improve crop performance, particularly growth and yield.
Acknowledgements
This work was supported by the funds of the National Natural Science Foundation of China (31971858 and 31471449), Guangxi Special Fund for Scientific Base and Talent (GKAD17195100), Fund for Guangxi Key Laboratory of Sugarcane Genetic Improvement (19-185-24-K-03-01), Fund for Guangxi Innovation Teams of Modern Agriculture Technology (nycytxgxcxtd-2021-03).
Human or animal participants
The current article does not possess any studies with humans. Rabbits bought from ABclonal Biotechnology co., Ltd. Rabbits were placed in a standard 12 h light-dark cycle with free access to food and water.
Declaration of competing interest
No conflicts of interest were declared.
References
- Hoffman BM, Lukoyanov D, Yang Z-Y, Dean DR, Seefeldt LC. Mechanism of nitrogen fixation by nitrogenase: The next stage. Chem Rev. 2014; 114(8):4041-4062. DOI
- Pankievicz VCS, do Amaral FP, Ané J-M, Stacey G. Diazotrophic bacteria and their mechanisms to interact and benefit cereals. Mol Plant-Microbe Interact. 2021; 34(5):491-498. DOI
- Boddey RM, Urquiaga S, Alves BJR, Reis V. Endophytic nitrogen fixation in sugarcane: present knowledge and future applications. Plant Soil. 2003; 252(1):139-149. DOI
- Gaby JC, Buckley DH. A comprehensive aligned nifH gene database: a multipurpose tool for studies of nitrogen-fixing bacteria. Database. 2014; 2014DOI
- Meiler S, Britten GL, Dutkiewicz S, Gradoville MR, Moisander PH, Jahn O, et al. Constraining uncertainties of diazotroph biogeography from nifH gene abundance. Limnol Oceanogr. 2022; 67(4):816-829. DOI
- Addo MA, Dos Santos PC. Distribution of nitrogen-fixation genes in prokaryotes containing alternative nitrogenases. Chem Bio Chem. 2020; 21(12):1749-1759. DOI
- Berman J, Gershoni JM, Zamir A. Expression of nitrogen fixation genes in foreign hosts. J Biol Chem. 1985; 260(9):5240-5243. DOI
- Arnold W, Rump A, Klipp W, Priefer UB, Pühler A. Nucleotide sequence of a 24,206-base-pair DNA fragment carrying the entire nitrogen fixation gene cluster of Klebsiella pneumoniae. J Mol Biol. 1988; 203(3):715-738. DOI
- Rosenblueth M, Martínez L, Silva J, Martínez-Romero E. Klebsiella variicola, a novel species with clinical and plant-associated isolates. Syst Appl Microbiol. 2004; 27(1):27-35. DOI
- Lin L, Wei CY, Chen MY, Wang HC, Li YY, Li YR, et al. Complete genome sequence of endophytic nitrogen-fixing Klebsiella variicola strain DX120E. Stand Genomic Sci. 2015; 10(1):22. DOI
- Wei CY, Lin L, Luo LJ, Xing YX, Hu CJ, Yang LT, et al. Endophytic nitrogen-fixing Klebsiella variicola strain DX120E promotes sugarcane growth. Biol Fertil Soils. 2014; 50(4):657-666. DOI
- Alhashem Y, Farid A, Al Mohaini M, Muzammal M, Khan M, Dadrasnia A, et al. Protein isolation and separation techniques of Pasteurella multocidavia one-and two-dimen-sional gel electrophoresis. ;14:1-8. 2022; 14:1-8. DOI
- Masood S, Zhao XQ, Shen RF. Bacillus pumilus promotes the growth and nitrogen uptake of tomato plants under nitrogen fertilization. Sci Hortic. 2020; 272:109581. DOI
- Wu W, Yin C, Yue A, Niu J, Du W, Liu D, et al. Rapid and visual detection of soybean mosaic virus SC7 with a loop-mediated isothermal amplification strategy. Sens Actuators B. 2022; 373:132733. DOI
- Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001; 25(4):402-408. DOI
- Zhou G, Yang LT, Li YR, Zou CL, Huang LP, Qiu LH, et al. Proteomic analysis of osmotic stress-responsive proteins in sugarcane leaves. Plant Mol Biol Rep. 2012; 30(2):349-359. DOI
- Taylor SC, Posch A. The design of a quantitative western blot experiment. BioMed Res Int. 2014; 2014
- Zhang KK, Niu JQ, Wei CY, Xing YX. Cloning and sequence analysis on nifH gene of Klebsiella variicola DX120E isolated from sugarcane. J South Agric. 2014; 45(10):1719-1725.
- Singh RK, Singh P, Sharma A, Guo DJ, Upadhyay SK, Song QQ, et al. Unraveling nitrogen fixing potential of endophytic diazotrophs of different Saccharum species for sustainable sugarcane growth. Int J Mol Sci. 2022; 23(11):6242. DOI
- de Lima DRM, dos Santos IB, Oliveira JTC, da Costa DP, de Queiroz JVJ, Romagnoli EM, et al. Genetic diversity of N-fixing and plant growth-promoting bacterial community in different sugarcane genotypes, association habitat and phenological phase of the crop. Arch Microbiol. 2021; 203(3):1089-1105. DOI
- Staples CR, Lahiri S, Raymond J, Herbulis LV, Mukhophadhyay B, Blankenship RE. Expression and association of group IV nitrogenase nifD and nifH homologs in the non-nitrogen-fixing archaeon Methanocaldococcus jannaschii. J Bacteriol. 2007; 189(20):7392-7398. DOI
- Li Q, He XJ, Liu PX, Zhang HW, Wang MY, Chen SF. Synthesis of nitrogenase by Paenibacillus sabinae T27 in presence of high levels of ammonia during anaerobic fermentation. Appl Microbiol Biotechnol. 2021; 105(7):2889-2899. DOI
- Li H-B, Singh RK, Singh P, Song Q-Q, Xing Y-X, Yang L-T, et al. Genetic diversity of nitrogen-fixing and plant growth promoting Pseudomonas species isolated from sugarcane rhizosphere. Front Microbiol. 2017; 8DOI
- Hardoim PR, Overbeek LSv, Berg G, Pirttilä AM, Compant S, Campisano A, et al. The hidden world within plants: ecological and evolutionary considerations for defining functioning of microbial endophytes. Microbiol Mol Biol R. 2015; 79(3):293-320. DOI
- Gavini N, Burgess BK. FeMo cofactor synthesis by a nifH mutant with altered MgATP reactivity. J Biol Chem. 1992; 267(29):21179-21186. DOI
- Chang CL, Davis LC, Rider M, Takemoto DJ. Characterization of nifH mutations of Klebsiella pneumoniae. J Bacteriol. 1988; 170(9):4015-4022. DOI
- Sevilla M, Burris RH, Gunapala N, Kennedy C. Comparison of benefit to sugarcane plant growth and 15N2 incorporation following inoculation of sterile plants with Acetobacter diazotrophicus wild-type and nif- mutant strains. Mol Plant-Microbe Interact. 2001; 14(3):358-366. DOI
- Chen M, Li Y, Li S, Tang L, Zheng J, An Q. Genomic identification of nitrogen-fixing Klebsiella variicola, K. pneumoniae and K. quasipneumoniae. J Basic Microb. 2016; 56(1):78-84. DOI