Taromchi, A., Kazemi, B., Mahmazi, S., Bandehpour, M. (2013). Heterologous Expression of Human IL-29 (IFN-λ1) in Iranian Lizard Leishmania. Iranian Journal of Biotechnology, 11(3), 168-174. doi: 10.5812/ijb.12468
Amir Hossein Taromchi; Bahram Kazemi; Sanaz Mahmazi; Mojgan Bandehpour. "Heterologous Expression of Human IL-29 (IFN-λ1) in Iranian Lizard Leishmania". Iranian Journal of Biotechnology, 11, 3, 2013, 168-174. doi: 10.5812/ijb.12468
Taromchi, A., Kazemi, B., Mahmazi, S., Bandehpour, M. (2013). 'Heterologous Expression of Human IL-29 (IFN-λ1) in Iranian Lizard Leishmania', Iranian Journal of Biotechnology, 11(3), pp. 168-174. doi: 10.5812/ijb.12468
Taromchi, A., Kazemi, B., Mahmazi, S., Bandehpour, M. Heterologous Expression of Human IL-29 (IFN-λ1) in Iranian Lizard Leishmania. Iranian Journal of Biotechnology, 2013; 11(3): 168-174. doi: 10.5812/ijb.12468
Heterologous Expression of Human IL-29 (IFN-λ1) in Iranian Lizard Leishmania
1Biotechnology Department, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
2Department of Genetics, Zanjan Branch, Islamic Azad University, Zanjan, IR Iran
3Biotechnology Department, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
and
Cellular and Molecular Biology Research Center, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
Abstract
Background: Interferons with diffrent functions such as antiviral, antiproliferative and immunomodulatory actions are effctive medications for a number of diseases. One of these new interferons (IFNs) is Interleukin-29 (IL-29) belongs to the family of IFN-λ has antiviral activity and its potent in accompanying with IFN-α in treatment of HCV infection has been evaluated (clinical trial phase II). Recombinant IL-29 has been previously produced in multiple expression systems but in this study we cloned and expressed this protein in an Iranian Lizard leishmania (I.L.L) for the fist time. Objectives: The Main objective of this research was to evaluate expression of functional human IL-29 in domestic Lizard leishmania as an alternative eukaryotic expression system. Materials and Methods: The IL-29 expression cassette was constructed into a pLEXSY vector. The leishmania cells were transfected by electroporation. After selection of transfectants, the protein expression was evaluated at RNA and protein levels. Results: Expression cassette was successfully transfected to leishmania cells and expression of recombinant IL-29 was proved by RT-PCR and western blotting. Purifid protein showed 20% activity compared to standard protein. Enzymatic removal of N-glycan resulted to the shift of protein mobility on SDS-PAGE. Conclusions: Easy handling and culture of this eukaryotic host and mammalian cell like posttranslational modifiations are the main advantages of this expression host, but the expression yield of this protein is very low and it seems to be not economic for large-scale production.
1. Background Interferons (IFNs) are the most important proteins among the cytokines, which have the variety of roles such as antiviral, antiproliferation and immunomodulation activities. Human Interferons divided into three types as: type I containing IFN α (13 subtypes), IFN β, κ, ε , ω, τ, ζ , δ and ν subtypes (1). Type II of interferon family consists of a single member IFN γ. All of the interferons type I interact with the same type of receptors on the cell surface consisted of the heterodimeric complex of IFN-αβR (2, 3). Type I IFNs are responsible for inducing transcription of a large cluster of genes which play a role in host resistance to viral infections, as well as activation of key components in innate and adaptive immune systems including antigen presentation and production of cytokines involved in activation of T cells, B cells, and natural killer cells. The class 1 IFNs, IFN-α and IFN-β, are predominantly immunomodulatory and antiviral factors, whereas IFN-γ has a greater antiproliferative effct. IFN-α is, a family of at least 16 related peptides- 18 - 20 KDa in size- coded by the genes located on chromosome 9 with 85% homology between diffrent members of the group (4). Type III of interferon has three IFN-λ (lambda) molecules called IFN-λ1, IFN-λ2 and IFN-λ3 (also called IL29, IL28A and IL28B respectively) (2, 3). These proteins encoded by 3 diffrent genes located on chromosome 19. At the amino acid level IFN-λ2 and -λ3 are highly similar with 96% sequence identity while IFN-λ1 shares approximately 81 % sequence identity with IFN-λ2 and -λ3 (5). After cleavage of the predicted 25 (IL- 28A, IL-28B) or 19 (IL-29) amino acid-long signal peptides, the mature polypeptides of IL-28A and IL-28B comprised of 175 amino acids (6). There is no potential N-glycosylation and only one possible O-glycosylation site in IL-28A and IL-28B were observed. The IL-29 gene encodes a mature, secreted IL-29 protein of 181 amino acids, which possess one potential N-glycosylation site and its 3-D structure is comprised of a monomeric α-helical protein, with
topological similarity to IL-10 and other members of the IL-10 family of cytokines. IFN-λs represented an evolutionary link between IL-10 and type I IFNs. These cytokines are expressed by human peripheral blood mononuclear cells and dendritic cells upon infection with viruses or activation of toll-like receptors (TLRs). The IFN-λs do not bind to the IFN-αβ receptor, instead they exert their activity through a distinct receptor (6). Interferon lambda family receptor composed of two chains, IL-28Rα subunit which is IFN-λ specifi and also responsible for signal transduction and IL-10Rβ subunit that is common among IL-10, IL- 22 and IL-26 (2, 3, 7-9). IFN-λ family members (IL-28A, IL-28B and IL-29), same as type I interferons, after binding to their receptor complex, would activate the signal transduction via activation of JAK/STAT pathway that fially leads to the target gene regulation by STAT molecules. These interferon stimulated genes (ISGs) encodin proteins such as Mx1, OAS or IFIT, which mediate the antiviral effcts of IFN (10). Type III IFN was also shown to display antiproliferative and immunomodulatory properties similar to IFN type I members (8, 11-14). Recombinant IFN-λ1 (IL-29) was previously produced in Escherichia coli, human A549 cell, Pichia pastoris, mouse NSO cell and CHO cell line (15-18). Leishmania sp. Protozoa from the family of Trypanosomatidae, is another expression system with some unique features such as RNA editing, arrangement of genes in tandem arrays, polycistronic transcription followed by trans splicing, and regulation of gene expression almost exclusively at the post-transcriptional level, high growth rate and easy handling like E. coli and yeast expression systems (19-21). In this study we selected Iranian Lizard leishmania (I.L.L.) for expression of recombinant human IL-29 (IFN-λ1) (22). 2. Objectives This species of Lizard leishmania was isolated in Iran which its potency to express the coagulation factor VII was evaluated by Mirzaahmadi et al. (21). The main objective of this research was the evaluation of this host capability in expression of functional and glycosylated human IL-29 as an alternative host for eukaryotic expression systems. 3. Materials and Methods 3.1. Cultivation of Iranian Lizard Leishmania (I.L.L.) Iranian Lizard Leishmania I.L.L (22) was cultivated at 26°C in RPMI 1640 (GIBCO, UK) containing 5% fetal bovine serum, 100 units.mL -1 penicillin and 100 µg.mL -1 streptomycin (GIBCO, Pen-Strep15140), hygromycin (SIGMA, 50 µg/mL for selection of recombinant clones). leishmania maintaining culture was maintained at 26°C with diluting suspensions in 5-10 folds into fresh medium twice per week. For expression studies I.L.L was grown using a rotating incubator (140 rpm) and harvested after 48 hours. 3.2. Cloning of IL-29 (IFN-λ1) Gene Fragment into Iranian Lizard Leishmania (I.L.L.) The human IL-29 gene sequence (Gen Bank accession number AY336716) was used as a template to synthesis the gene by adding Sal I and Kpn I restriction sites at up and downstream. Synthesized IL-29 gene in the pGH vector (Nedayefan, Iran) was amplifid using flnking M13 primers (Table 1) and then digested with Sal I and Kpn I restriction enzymes (Ferments, Lithuania) to produce a558 bp gene fragment which then cloned in the pLEXSY-hyg2 plasmid (EGE-232, Jena Bioscience, Germany). In-silico prediction of Cleavage site for signal peptide (L. Mexicana secreted acid phosphatase LMSAP1) linked to IL-29 gene was performed by online Signal program. Resulting construct encoding the IL-29 fused to the C-terminal His 6 tag and N-terminal signal peptide of pLEXSY-hyg2 was transformed into E. coli XL1-Blue (stratagene). Desired recombinant clone was selected by colony PCR using P1442 and A264 primers (Table 1) flnking the multiple cloning site of pLEXSY-hyg2 plasmid and then confimed by digestion with PpumI enzyme which has a restriction site on IL-29 gene and caused to produce the linear form of a plasmid. At the fial step and before transfection, IL-29 gene segment was sequenced using P1442 and A264 primers. 3.3. Transfection of I.L.L. The fial construct (pLEXSY -hyg2-IL-29) was purifid by Plasmid Miniprep Kit (Bioneer, Korea) and linearized by SwaI (Ferments, Lithuania) and the pure expression cassette was isolated by QIAquick Gel Extraction Kit (QIAGEN, USA). 5 µg of DNA used for transfection of I.L.L. by electroporation (gene pulser Xcell, Biorad) (23, 24). Stable transfectants were selected on RPMI media containing 25 μgmL -1 hygromycin B after one week and a stringent selection was continued by increasing the concentration of hygromycin up to 100 μgmL -1 for another week. For investigating evaluation of the expression cassette into the ssu locus of I.L.L., 1 mL aliquot of culture was subjected to genomic DNA extraction and diagnostic PCR was performed using IL-29 reverse primer and F3001 forward primer (Table 1) which located in the leishmania ssu gene (annealing temperature 62 °C) (25). 3.4. Expression of Recombinant IL-29 Expression of the integrated IL-29 gene was evaluated by RT-PCR and western blot tests. Selected positive transfectants of I.L.L. were grown for 48h incessantly (140rpm). When cell density reached to about 1x108 cells, it was centrifuged for 5 min at 3000. The total RNA were extracted by RNeasy mini kit (QIAGEN) and cDNA synthesis was conducted by random hexamers and PCR was carried out with IL-29 specifi primers (Table 1, annealing 65 °C). To
analysis the protein secretion, 16 mL of fitered culture supernatant was mixed with 4 mL 50% ice-cold trichloroacetic acid and incubated for 30 minutes on ice then centrifuged for 15 minutes at 12000 rpm. Supernatant was removed completely and then the pellet was resuspended in 1 mL acetone and centrifuged for 15 minutes at 13000 g and 4 ºC. The pellet was dried and resuspended in gel loading buffr for SDS-PAGE and western blot analysis. As mentioned above, for western blot analysis the cultured cells electrophoresed in 12% gel, then transferred to nitrocellulose membrane. The membrane was blocked for 1 hour at room temperature in TBS buffr (20 mM Tris and 150 mM NaCl, pH 7.6) containing 3% nonfat dry milk followed by a 2-hour incubation in the same buffr containing 1000 fold dilution of rabbit anti-IL-29 antibody (Abcam, UK). After 3 - 5 washings with TBST (TBS + 0.1% tween - 20) the membrane was incubated again for 2 h at room temperature in TBS containing 10,000-fold dilution of alkaline phosphatase-conjugated goat antirabbit antibody (Abcam, UK), followed by rinsing 5 times in TBST. Color development was achieved by adding alkaline phosphatase substrate (NBT and BCIP) to presoaked membrane in alkaline phosphatase buffr (100 mM diethanolamine, 100 mM NaCl, 5 mM MgCl2, pH 9.5). Table 1. Oligonucleotides sequence Used in this Study Name Sequence (5'to 3') M13 F GTAAAACGACGGCCAGTG M13R GGAAACAGCTATGACCATG IL-29 F GTCGACGCTGGCCCTGTCCCCACTTC IL-29 R GGTACCGGTGGACTCAGGGTGGGTTG P 1442 CCGACTGCAACAAGGTGTAG A 264 CATCTATAGAGAAGTACACGTAAAAG F 3001 GATCTGGTTGATTCTGCCAGTAG 3.5. Purifiation of Recombinant IL-29 Purifiation of recombinant IL-29 fused to His-tag was performed on I.L.L. Host cells were incubated for 48h at 140 rpm. They were centrifuged for 10 min at 3000 and washed with PBS. Cleared cell lysates was prepared by adding 5 mL buffr B (Urea, NaH2PO4, Tris-Cl, pH 8.0) to cell pellets. Cell lysis was performed by gently vortexing at room temperature. When solution became translucent, cell debris was removed by centrifugation at for 20 minutes. 1 mL of the Ni-NTA His-bind resin (Novagen, Merck) was added to lysate and mixed gently by shaking for 60 minutes at room temperature. Lysate –resin mixture was loaded into an empty column and after flw through collection, the resin was washed with 2 X 4 mL buffr C ( urea, NaH 2PO4, Tris-Cl, pH 6.3) followed by two step elution: fist with 2 mL buffr D ( urea, NaH2PO4, Tris-Cl, pH 5.9) and fially with 2 mL buffr E ( urea, NaH2PO4, Tris-Cl, pH 4.5). Final eluted proteins were pooled and concentrated by ultrafitration using Amicon Ultra-15 units with a cut-of of 10 kDa (Millipore, Germany). 3.6. Antiviral Assay The antiviral activity of purifid recombinant IL-29 was measured as previously described (26, 27). Briefl trypsinized A549 cell line was re-suspended as single-cell suspensions then seeded in 96 - well microtiter plates at 3.1 × 104 per well and incubated at 37 °C in 5% CO2 for 16 h. The serial 10 fold dilutions of purifid recombinant IL-29 and recombinant standard IL-29 (R&D systems, USA) were prepared with culture medium and then transferred to plate in duplicate rows. After 24 h incubation, the culture medium was drained and replaced by medium containing Encephalomyocarditis virus (EMCV) in all wells, except control cells with multiplicity of infection (m.o.i) of 10 plaque forming units per cell (pfu.cell -1). Plates were incubated for 24 h at 37 °C, then cells were washed with PBS and stained with 0.05% amido-blue black in 0.1 M sodium acetate buffr for 0.5 h at room temperature. After fiation with 4% formalin acetate, cells were washed, dried and then absorbed color was released by 0.1 M sodium hydroxide. Finally absorbance read at 630 nm. Dose related responses were plotted as absorbance versus cytokine concentration. 3.7. Glycosylation Study There is a potential site of N-glycosylation in the IL-29 structure. Glycan enzymatic cleavage of the polypeptide using glycosidases is one of the techniques that do not require special devices. Using this approach, N-linked oligosaccharides are cleaved from the polypeptide by Nglycosidase F (PNGase F, Sigma). Electrophoretic mobility of protein before and after treatment with glycosidase was compared. 4. Results 4.1. Construction of Recombinant pLEXSY – hyg 2 - IL-29 Plasmid In order to obtain a high concentration of IL-29 gene for the ligation reaction, PCR reaction was performed using flnking M13 primers on recombinant pGH-IL-29 construct. PCR product digested with KpnI and SalI restriction enzymes. This gene fragment was inserted into pLEXSYhyg 2 expression vector. In-silico SignalP assigns a probability of ~97% for cleavage of signal peptide between the 23rd and 24 th amino acids. Desired clone of transformed E. coli was selected as described in materials and methods (2.2) which had a PCR product of about 840 bp vs. clones with 1300 bp-product which contained pLEXSY vectors with re-ligated stuffr instead of desired insert (Figure 1 A). Plasmid extracted from this clone also subjected to further confimation by digesting with PpumI enzyme (Figure 1 B). Sequencing results revealed that IL-29 gene segment was accurately amplifid and located in the correct position. 4.2. Transfection and Selection of Recombinant I.L.L. Cells Purifid pLEXSY - hyg2 – IL-29 was digested by Swa I and the needless parts (ori and bla) were removed and a 5800 bp pure expression cassette was eluted from the gel to