Document Type : Research Paper
Authors
1 Biotechnology Department, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
2 Department of Genetics, Zanjan Branch, Islamic Azad University, Zanjan, IR Iran
3 Biotechnology Department, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran and Cellular and Molecular Biology Research Center, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
Abstract
Keywords
1. Background
Interferons (IFNs) are the most important proteins
among the cytokines, which have the variety of roles such
as antiviral, antiproliferation and immunomodulation
activities. Human Interferons divided into three types as:
type I containing IFN α (13 subtypes), IFN β, κ, ε , ω, τ, ζ ,
δ and ν subtypes (1). Type II of interferon family consists
of a single member IFN γ. All of the interferons type I interact with the same type of receptors on the cell surface
consisted of the heterodimeric complex of IFN-αβR (2, 3).
Type I IFNs are responsible for inducing transcription of a
large cluster of genes which play a role in host resistance
to viral infections, as well as activation of key components
in innate and adaptive immune systems including antigen presentation and production of cytokines involved
in activation of T cells, B cells, and natural killer cells. The
class 1 IFNs, IFN-α and IFN-β, are predominantly immunomodulatory and antiviral factors, whereas IFN-γ has a
greater antiproliferative effct. IFN-α is, a family of at least
16 related peptides- 18 - 20 KDa in size- coded by the genes
located on chromosome 9 with 85% homology between
diffrent members of the group (4). Type III of interferon
has three IFN-λ (lambda) molecules called IFN-λ1, IFN-λ2
and IFN-λ3 (also called IL29, IL28A and IL28B respectively)
(2, 3). These proteins encoded by 3 diffrent genes located
on chromosome 19. At the amino acid level IFN-λ2 and
-λ3 are highly similar with 96% sequence identity while
IFN-λ1 shares approximately 81 % sequence identity with
IFN-λ2 and -λ3 (5). After cleavage of the predicted 25 (IL-
28A, IL-28B) or 19 (IL-29) amino acid-long signal peptides,
the mature polypeptides of IL-28A and IL-28B comprised
of 175 amino acids (6). There is no potential N-glycosylation and only one possible O-glycosylation site in IL-28A
and IL-28B were observed. The IL-29 gene encodes a mature, secreted IL-29 protein of 181 amino acids, which possess one potential N-glycosylation site and its 3-D structure is comprised of a monomeric α-helical protein, with
topological similarity to IL-10 and other members of the
IL-10 family of cytokines. IFN-λs represented an evolutionary link between IL-10 and type I IFNs. These cytokines are
expressed by human peripheral blood mononuclear cells
and dendritic cells upon infection with viruses or activation of toll-like receptors (TLRs). The IFN-λs do not bind
to the IFN-αβ receptor, instead they exert their activity
through a distinct receptor (6). Interferon lambda family
receptor composed of two chains, IL-28Rα subunit which
is IFN-λ specifi and also responsible for signal transduction and IL-10Rβ subunit that is common among IL-10, IL-
22 and IL-26 (2, 3, 7-9).
IFN-λ family members (IL-28A, IL-28B and IL-29), same
as type I interferons, after binding to their receptor complex, would activate the signal transduction via activation
of JAK/STAT pathway that fially leads to the target gene
regulation by STAT molecules. These interferon stimulated genes (ISGs) encodin proteins such as Mx1, OAS or
IFIT, which mediate the antiviral effcts of IFN (10). Type
III IFN was also shown to display antiproliferative and immunomodulatory properties similar to IFN type I members (8, 11-14). Recombinant IFN-λ1 (IL-29) was previously
produced in Escherichia coli, human A549 cell, Pichia pastoris, mouse NSO cell and CHO cell line (15-18). Leishmania
sp. Protozoa from the family of Trypanosomatidae, is another expression system with some unique features such
as RNA editing, arrangement of genes in tandem arrays,
polycistronic transcription followed by trans splicing,
and regulation of gene expression almost exclusively at
the post-transcriptional level, high growth rate and easy
handling like E. coli and yeast expression systems (19-21).
In this study we selected Iranian Lizard leishmania (I.L.L.)
for expression of recombinant human IL-29 (IFN-λ1) (22).
2. Objectives
This species of Lizard leishmania was isolated in Iran
which its potency to express the coagulation factor VII
was evaluated by Mirzaahmadi et al. (21). The main objective of this research was the evaluation of this host
capability in expression of functional and glycosylated
human IL-29 as an alternative host for eukaryotic expression systems.
3. Materials and Methods
3.1. Cultivation of Iranian Lizard Leishmania (I.L.L.)
Iranian Lizard Leishmania I.L.L (22) was cultivated at 26°C
in RPMI 1640 (GIBCO, UK) containing 5% fetal bovine serum, 100 units.mL -1 penicillin and 100 µg.mL -1 streptomycin (GIBCO, Pen-Strep15140), hygromycin (SIGMA, 50
µg/mL for selection of recombinant clones). leishmania
maintaining culture was maintained at 26°C with diluting suspensions in 5-10 folds into fresh medium twice per
week. For expression studies I.L.L was grown using a rotating incubator (140 rpm) and harvested after 48 hours.
3.2. Cloning of IL-29 (IFN-λ1) Gene Fragment into
Iranian Lizard Leishmania (I.L.L.)
The human IL-29 gene sequence (Gen Bank accession
number AY336716) was used as a template to synthesis
the gene by adding Sal I and Kpn I restriction sites at up
and downstream. Synthesized IL-29 gene in the pGH vector (Nedayefan, Iran) was amplifid using flnking M13
primers (Table 1) and then digested with Sal I and Kpn I restriction enzymes (Ferments, Lithuania) to produce a558
bp gene fragment which then cloned in the pLEXSY-hyg2
plasmid (EGE-232, Jena Bioscience, Germany). In-silico
prediction of Cleavage site for signal peptide (L. Mexicana
secreted acid phosphatase LMSAP1) linked to IL-29 gene
was performed by online Signal program. Resulting construct encoding the IL-29 fused to the C-terminal His 6 tag
and N-terminal signal peptide of pLEXSY-hyg2 was transformed into E. coli XL1-Blue (stratagene). Desired recombinant clone was selected by colony PCR using P1442 and
A264 primers (Table 1) flnking the multiple cloning site
of pLEXSY-hyg2 plasmid and then confimed by digestion
with PpumI enzyme which has a restriction site on IL-29
gene and caused to produce the linear form of a plasmid.
At the fial step and before transfection, IL-29 gene segment was sequenced using P1442 and A264 primers.
3.3. Transfection of I.L.L.
The fial construct (pLEXSY -hyg2-IL-29) was purifid
by Plasmid Miniprep Kit (Bioneer, Korea) and linearized
by SwaI (Ferments, Lithuania) and the pure expression
cassette was isolated by QIAquick Gel Extraction Kit (QIAGEN, USA). 5 µg of DNA used for transfection of I.L.L. by
electroporation (gene pulser Xcell, Biorad) (23, 24). Stable
transfectants were selected on RPMI media containing
25 μgmL -1 hygromycin B after one week and a stringent
selection was continued by increasing the concentration
of hygromycin up to 100 μgmL -1 for another week. For investigating evaluation of the expression cassette into the
ssu locus of I.L.L., 1 mL aliquot of culture was subjected
to genomic DNA extraction and diagnostic PCR was performed using IL-29 reverse primer and F3001 forward
primer (Table 1) which located in the leishmania ssu gene
(annealing temperature 62 °C) (25).
3.4. Expression of Recombinant IL-29
Expression of the integrated IL-29 gene was evaluated
by RT-PCR and western blot tests. Selected positive transfectants of I.L.L. were grown for 48h incessantly (140rpm).
When cell density reached to about 1x108 cells, it was centrifuged for 5 min at 3000. The total RNA were extracted
by RNeasy mini kit (QIAGEN) and cDNA synthesis was
conducted by random hexamers and PCR was carried out
with IL-29 specifi primers (Table 1, annealing 65 °C). To
analysis the protein secretion, 16 mL of fitered culture
supernatant was mixed with 4 mL 50% ice-cold trichloroacetic acid and incubated for 30 minutes on ice then
centrifuged for 15 minutes at 12000 rpm. Supernatant
was removed completely and then the pellet was resuspended in 1 mL acetone and centrifuged for 15 minutes at
13000 g and 4 ºC. The pellet was dried and resuspended in
gel loading buffr for SDS-PAGE and western blot analysis.
As mentioned above, for western blot analysis the cultured cells electrophoresed in 12% gel, then transferred to
nitrocellulose membrane. The membrane was blocked
for 1 hour at room temperature in TBS buffr (20 mM
Tris and 150 mM NaCl, pH 7.6) containing 3% nonfat dry
milk followed by a 2-hour incubation in the same buffr
containing 1000 fold dilution of rabbit anti-IL-29 antibody (Abcam, UK). After 3 - 5 washings with TBST (TBS +
0.1% tween - 20) the membrane was incubated again for
2 h at room temperature in TBS containing 10,000-fold
dilution of alkaline phosphatase-conjugated goat antirabbit antibody (Abcam, UK), followed by rinsing 5 times
in TBST. Color development was achieved by adding alkaline phosphatase substrate (NBT and BCIP) to presoaked
membrane in alkaline phosphatase buffr (100 mM diethanolamine, 100 mM NaCl, 5 mM MgCl2, pH 9.5).
Table 1. Oligonucleotides sequence Used in this Study
Name Sequence (5'to 3')
M13 F GTAAAACGACGGCCAGTG
M13R GGAAACAGCTATGACCATG
IL-29 F GTCGACGCTGGCCCTGTCCCCACTTC
IL-29 R GGTACCGGTGGACTCAGGGTGGGTTG
P 1442 CCGACTGCAACAAGGTGTAG
A 264 CATCTATAGAGAAGTACACGTAAAAG
F 3001 GATCTGGTTGATTCTGCCAGTAG
3.5. Purifiation of Recombinant IL-29
Purifiation of recombinant IL-29 fused to His-tag was
performed on I.L.L. Host cells were incubated for 48h at
140 rpm. They were centrifuged for 10 min at 3000 and
washed with PBS. Cleared cell lysates was prepared by
adding 5 mL buffr B (Urea, NaH2PO4, Tris-Cl, pH 8.0) to
cell pellets. Cell lysis was performed by gently vortexing
at room temperature. When solution became translucent, cell debris was removed by centrifugation at for 20
minutes. 1 mL of the Ni-NTA His-bind resin (Novagen, Merck) was added to lysate and mixed gently by shaking for
60 minutes at room temperature. Lysate –resin mixture
was loaded into an empty column and after flw through
collection, the resin was washed with 2 X 4 mL buffr C (
urea, NaH
2PO4, Tris-Cl, pH 6.3) followed by two step elution: fist with 2 mL buffr D ( urea, NaH2PO4, Tris-Cl, pH
5.9) and fially with 2 mL buffr E ( urea, NaH2PO4, Tris-Cl,
pH 4.5). Final eluted proteins were pooled and concentrated by ultrafitration using Amicon Ultra-15 units with
a cut-of of 10 kDa (Millipore, Germany).
3.6. Antiviral Assay
The antiviral activity of purifid recombinant IL-29 was
measured as previously described (26, 27). Briefl trypsinized A549 cell line was re-suspended as single-cell suspensions then seeded in 96 - well microtiter plates at 3.1
× 104 per well and incubated at 37 °C in 5% CO2 for 16 h.
The serial 10 fold dilutions of purifid recombinant IL-29
and recombinant standard IL-29 (R&D systems, USA) were
prepared with culture medium and then transferred to
plate in duplicate rows. After 24 h incubation, the culture
medium was drained and replaced by medium containing Encephalomyocarditis virus (EMCV) in all wells, except
control cells with multiplicity of infection (m.o.i) of 10
plaque forming units per cell (pfu.cell -1). Plates were incubated for 24 h at 37 °C, then cells were washed with PBS
and stained with 0.05% amido-blue black in 0.1 M sodium
acetate buffr for 0.5 h at room temperature. After fiation with 4% formalin acetate, cells were washed, dried
and then absorbed color was released by 0.1 M sodium
hydroxide. Finally absorbance read at 630 nm. Dose related responses were plotted as absorbance versus cytokine
concentration.
3.7. Glycosylation Study
There is a potential site of N-glycosylation in the IL-29
structure. Glycan enzymatic cleavage of the polypeptide
using glycosidases is one of the techniques that do not
require special devices. Using this approach, N-linked
oligosaccharides are cleaved from the polypeptide by Nglycosidase F (PNGase F, Sigma). Electrophoretic mobility
of protein before and after treatment with glycosidase
was compared.
4. Results
4.1. Construction of Recombinant pLEXSY – hyg 2 -
IL-29 Plasmid
In order to obtain a high concentration of IL-29 gene for
the ligation reaction, PCR reaction was performed using
flnking M13 primers on recombinant pGH-IL-29 construct. PCR product digested with KpnI and SalI restriction
enzymes. This gene fragment was inserted into pLEXSYhyg 2 expression vector. In-silico SignalP assigns a probability of ~97% for cleavage of signal peptide between the
23rd and 24 th amino acids. Desired clone of transformed
E. coli was selected as described in materials and methods
(2.2) which had a PCR product of about 840 bp vs. clones
with 1300 bp-product which contained pLEXSY vectors
with re-ligated stuffr instead of desired insert (Figure 1 A). Plasmid extracted from this clone also subjected to
further confimation by digesting with PpumI enzyme
(Figure 1 B). Sequencing results revealed that IL-29 gene
segment was accurately amplifid and located in the correct position.
4.2. Transfection and Selection of Recombinant
I.L.L. Cells
Purifid pLEXSY - hyg2 – IL-29 was digested by Swa I and
the needless parts (ori and bla) were removed and a 5800
bp pure expression cassette was eluted from the gel to
further transfection. Stable transfectants in 100 µg.ml
-1 of hygromycin was subjected to DNA extraction and
checked for appropriate recombination of interest IL-29
gene in leishmania chromosomal 18 srRNA locus (