Heterologous Expression of Human IL-29 (IFN-λ1) in Iranian Lizard Leishmania

Document Type: Research Paper

Authors

1 Biotechnology Department, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran

2 Department of Genetics, Zanjan Branch, Islamic Azad University, Zanjan, IR Iran

3 Biotechnology Department, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran and Cellular and Molecular Biology Research Center, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran

Abstract

Background: Interferons with diffrent functions such as antiviral, antiproliferative and immunomodulatory actions are effctive medications for a number of diseases. One of these new interferons (IFNs) is Interleukin-29 (IL-29) belongs to the family of IFN-λ has antiviral activity and its potent in accompanying with IFNin treatment of HCV infection has been evaluated (clinical trial phase II). Recombinant IL-29 has been previously produced in multiple expression systems but in this study we cloned and expressed this protein in an Iranian Lizard leishmania (I.L.L) for the fist time. Objectives: The Main objective of this research was to evaluate expression of functional human IL-29 in domestic Lizard leishmania as an alternative eukaryotic expression system. Materials and Methods: The IL-29 expression cassette was constructed into a pLEXSY vector. The leishmania cells were transfected by electroporation. After selection of transfectants, the protein expression was evaluated at RNA and protein levels. Results: Expression cassette was successfully transfected to leishmania cells and expression of recombinant IL-29 was proved by RT-PCR and western blotting. Purifid protein showed 20% activity compared to standard protein. Enzymatic removal of N-glycan resulted to the shift of protein mobility on SDS-PAGE. Conclusions: Easy handling and culture of this eukaryotic host and mammalian cell like posttranslational modifiations are the main advantages of this expression host, but the expression yield of this protein is very low and it seems to be not economic for large-scale production.

Keywords


1. Background
Interferons (IFNs) are the most important proteins
among the cytokines, which have the variety of roles such
as antiviral, antiproliferation and immunomodulation
activities. Human Interferons divided into three types as:
type I containing IFN α (13 subtypes), IFN β, κ, ε , ω, τ, ζ ,
δ and ν subtypes (1). Type II of interferon family consists
of a single member IFN γ. All of the interferons type I interact with the same type of receptors on the cell surface
consisted of the heterodimeric complex of IFN-αβR (2, 3).
Type I IFNs are responsible for inducing transcription of a
large cluster of genes which play a role in host resistance
to viral infections, as well as activation of key components
in innate and adaptive immune systems including antigen presentation and production of cytokines involved
in activation of T cells, B cells, and natural killer cells. The
class 1 IFNs, IFN-α and IFN-β, are predominantly immunomodulatory and antiviral factors, whereas IFN-γ has a
greater antiproliferative effct. IFN-α is, a family of at least
16 related peptides- 18 - 20 KDa in size- coded by the genes
located on chromosome 9 with 85% homology between
diffrent members of the group (4). Type III of interferon
has three IFN-λ (lambda) molecules called IFN-λ1, IFN-λ2
and IFN-λ3 (also called IL29, IL28A and IL28B respectively)
(2, 3). These proteins encoded by 3 diffrent genes located
on chromosome 19. At the amino acid level IFN-λ2 and
-λ3 are highly similar with 96% sequence identity while
IFN1 shares approximately 81 % sequence identity with
IFN-λ2 and -λ3 (5). After cleavage of the predicted 25 (IL-
28A, IL-28B) or 19 (IL-29) amino acid-long signal peptides,
the mature polypeptides of IL-28A and IL-28B comprised
of 175 amino acids (6). There is no potential N-glycosylation and only one possible O-glycosylation site in IL-28A
and IL-28B were observed. The IL-29 gene encodes a mature, secreted IL-29 protein of 181 amino acids, which possess one potential N-glycosylation site and its 3-D structure is comprised of a monomeric α-helical protein, with


topological similarity to IL-10 and other members of the
IL-10 family of cytokines. IFN-λs represented an evolutionary link between IL-10 and type I IFNs. These cytokines are
expressed by human peripheral blood mononuclear cells
and dendritic cells upon infection with viruses or activation of toll-like receptors (TLRs). The IFN-λs do not bind
to the IFN-αβ receptor, instead they exert their activity
through a distinct receptor (6). Interferon lambda family
receptor composed of two chains, IL-28Rα subunit which
is IFN-λ specifi and also responsible for signal transduction and IL-10Rβ subunit that is common among IL-10, IL-
22 and IL-26 (2, 3, 7-9).
IFN-λ family members (IL-28A, IL-28B and IL-29), same
as type I interferons, after binding to their receptor complex, would activate the signal transduction via activation
of JAK/STAT pathway that fially leads to the target gene
regulation by STAT molecules. These interferon stimulated genes (ISGs) encodin proteins such as Mx1, OAS or
IFIT, which mediate the antiviral effcts of IFN (10). Type
III IFN was also shown to display antiproliferative and immunomodulatory properties similar to IFN type I members (8, 11-14). Recombinant IFN-λ1 (IL-29) was previously
produced in Escherichia coli, human A549 cell, Pichia pastoris, mouse NSO cell and CHO cell line (15-18). Leishmania
sp. Protozoa from the family of Trypanosomatidae, is another expression system with some unique features such
as RNA editing, arrangement of genes in tandem arrays,
polycistronic transcription followed by trans splicing,
and regulation of gene expression almost exclusively at
the post-transcriptional level, high growth rate and easy
handling like E. coli and yeast expression systems (19-21).
In this study we selected Iranian Lizard leishmania (I.L.L.)
for expression of recombinant human IL-29 (IFN-λ1) (22).
2. Objectives
This species of Lizard leishmania was isolated in Iran
which its potency to express the coagulation factor VII
was evaluated by Mirzaahmadi et al. (21). The main objective of this research was the evaluation of this host
capability in expression of functional and glycosylated
human IL-29 as an alternative host for eukaryotic expression systems.
3. Materials and Methods
3.1. Cultivation of Iranian Lizard Leishmania (I.L.L.)
Iranian Lizard Leishmania I.L.L (22) was cultivated at 26°C
in RPMI 1640 (GIBCO, UK) containing 5% fetal bovine serum, 100 units.mL -1 penicillin and 100 µg.mL -1 streptomycin (GIBCO, Pen-Strep15140), hygromycin (SIGMA, 50
µg/mL for selection of recombinant clones). leishmania
maintaining culture was maintained at 26°C with diluting suspensions in 5-10 folds into fresh medium twice per
week. For expression studies I.L.L was grown using a rotating incubator (140 rpm) and harvested after 48 hours.
3.2. Cloning of IL-29 (IFN-λ1) Gene Fragment into
Iranian Lizard Leishmania (I.L.L.)
The human IL-29 gene sequence (Gen Bank accession
number AY336716) was used as a template to synthesis
the gene by adding Sal I and Kpn I restriction sites at up
and downstream. Synthesized IL-29 gene in the pGH vector (Nedayefan, Iran) was amplifid using flnking M13
primers (Table 1) and then digested with Sal I and Kpn I restriction enzymes (Ferments, Lithuania) to produce a558
bp gene fragment which then cloned in the pLEXSY-hyg2
plasmid (EGE-232, Jena Bioscience, Germany). In-silico
prediction of Cleavage site for signal peptide (L. Mexicana
secreted acid phosphatase LMSAP1) linked to IL-29 gene
was performed by online Signal program. Resulting construct encoding the IL-29 fused to the C-terminal His 6 tag
and N-terminal signal peptide of pLEXSY-hyg2 was transformed into E. coli XL1-Blue (stratagene). Desired recombinant clone was selected by colony PCR using P1442 and
A264 primers (Table 1) flnking the multiple cloning site
of pLEXSY-hyg2 plasmid and then confimed by digestion
with PpumI enzyme which has a restriction site on IL-29
gene and caused to produce the linear form of a plasmid.
At the fial step and before transfection, IL-29 gene segment was sequenced using P1442 and A264 primers.
3.3. Transfection of I.L.L.
The fial construct (pLEXSY -hyg2-IL-29) was purifid
by Plasmid Miniprep Kit (Bioneer, Korea) and linearized
by SwaI (Ferments, Lithuania) and the pure expression
cassette was isolated by QIAquick Gel Extraction Kit (QIAGEN, USA). 5 µg of DNA used for transfection of I.L.L. by
electroporation (gene pulser Xcell, Biorad) (23, 24). Stable
transfectants were selected on RPMI media containing
25 μgmL -1 hygromycin B after one week and a stringent
selection was continued by increasing the concentration
of hygromycin up to 100 μgmL -1 for another week. For investigating evaluation of the expression cassette into the
ssu locus of I.L.L., 1 mL aliquot of culture was subjected
to genomic DNA extraction and diagnostic PCR was performed using IL-29 reverse primer and F3001 forward
primer (Table 1) which located in the leishmania ssu gene
(annealing temperature 62 °C) (25).
3.4. Expression of Recombinant IL-29
Expression of the integrated IL-29 gene was evaluated
by RT-PCR and western blot tests. Selected positive transfectants of I.L.L. were grown for 48h incessantly (140rpm).
When cell density reached to about 1x108 cells, it was centrifuged for 5 min at 3000. The total RNA were extracted
by RNeasy mini kit (QIAGEN) and cDNA synthesis was
conducted by random hexamers and PCR was carried out
with IL-29 specifi primers (Table 1, annealing 65 °C). To


analysis the protein secretion, 16 mL of fitered culture
supernatant was mixed with 4 mL 50% ice-cold trichloroacetic acid and incubated for 30 minutes on ice then
centrifuged for 15 minutes at 12000 rpm. Supernatant
was removed completely and then the pellet was resuspended in 1 mL acetone and centrifuged for 15 minutes at
13000 g and 4 ºC. The pellet was dried and resuspended in
gel loading buffr for SDS-PAGE and western blot analysis.
As mentioned above, for western blot analysis the cultured cells electrophoresed in 12% gel, then transferred to
nitrocellulose membrane. The membrane was blocked
for 1 hour at room temperature in TBS buffr (20 mM
Tris and 150 mM NaCl, pH 7.6) containing 3% nonfat dry
milk followed by a 2-hour incubation in the same buffr
containing 1000 fold dilution of rabbit anti-IL-29 antibody (Abcam, UK). After 3 - 5 washings with TBST (TBS +
0.1% tween - 20) the membrane was incubated again for
2 h at room temperature in TBS containing 10,000-fold
dilution of alkaline phosphatase-conjugated goat antirabbit antibody (Abcam, UK), followed by rinsing 5 times
in TBST. Color development was achieved by adding alkaline phosphatase substrate (NBT and BCIP) to presoaked
membrane in alkaline phosphatase buffr (100 mM diethanolamine, 100 mM NaCl, 5 mM MgCl2, pH 9.5).
Table 1. Oligonucleotides sequence Used in this Study
Name Sequence (5'to 3')
M13 F GTAAAACGACGGCCAGTG
M13R GGAAACAGCTATGACCATG
IL-29 F GTCGACGCTGGCCCTGTCCCCACTTC
IL-29 R GGTACCGGTGGACTCAGGGTGGGTTG
P 1442 CCGACTGCAACAAGGTGTAG
A 264 CATCTATAGAGAAGTACACGTAAAAG
F 3001 GATCTGGTTGATTCTGCCAGTAG
3.5. Purifiation of Recombinant IL-29
Purifiation of recombinant IL-29 fused to His-tag was
performed on I.L.L. Host cells were incubated for 48h at
140 rpm. They were centrifuged for 10 min at 3000 and
washed with PBS. Cleared cell lysates was prepared by
adding 5 mL buffr B (Urea, NaH2PO4, Tris-Cl, pH 8.0) to
cell pellets. Cell lysis was performed by gently vortexing
at room temperature. When solution became translucent, cell debris was removed by centrifugation at for 20
minutes. 1 mL of the Ni-NTA His-bind resin (Novagen, Merck) was added to lysate and mixed gently by shaking for
60 minutes at room temperature. Lysate –resin mixture
was loaded into an empty column and after flw through
collection, the resin was washed with 2 X 4 mL buffr C (
urea, NaH
2PO4, Tris-Cl, pH 6.3) followed by two step elution: fist with 2 mL buffr D ( urea, NaH2PO4, Tris-Cl, pH
5.9) and fially with 2 mL buffr E ( urea, NaH2PO4, Tris-Cl,
pH 4.5). Final eluted proteins were pooled and concentrated by ultrafitration using Amicon Ultra-15 units with
a cut-of of 10 kDa (Millipore, Germany).
3.6. Antiviral Assay
The antiviral activity of purifid recombinant IL-29 was
measured as previously described (26, 27). Briefl trypsinized A549 cell line was re-suspended as single-cell suspensions then seeded in 96 - well microtiter plates at 3.1
× 104 per well and incubated at 37 °C in 5% CO2 for 16 h.
The serial 10 fold dilutions of purifid recombinant IL-29
and recombinant standard IL-29 (R&D systems, USA) were
prepared with culture medium and then transferred to
plate in duplicate rows. After 24 h incubation, the culture
medium was drained and replaced by medium containing Encephalomyocarditis virus (EMCV) in all wells, except
control cells with multiplicity of infection (m.o.i) of 10
plaque forming units per cell (pfu.cell -1). Plates were incubated for 24 h at 37 °C, then cells were washed with PBS
and stained with 0.05% amido-blue black in 0.1 M sodium
acetate buffr for 0.5 h at room temperature. After fiation with 4% formalin acetate, cells were washed, dried
and then absorbed color was released by 0.1 M sodium
hydroxide. Finally absorbance read at 630 nm. Dose related responses were plotted as absorbance versus cytokine
concentration.
3.7. Glycosylation Study
There is a potential site of N-glycosylation in the IL-29
structure. Glycan enzymatic cleavage of the polypeptide
using glycosidases is one of the techniques that do not
require special devices. Using this approach, N-linked
oligosaccharides are cleaved from the polypeptide by Nglycosidase F (PNGase F, Sigma). Electrophoretic mobility
of protein before and after treatment with glycosidase
was compared.
4. Results
4.1. Construction of Recombinant pLEXSY – hyg 2 -
IL-29 Plasmid
In order to obtain a high concentration of IL-29 gene for
the ligation reaction, PCR reaction was performed using
flnking M13 primers on recombinant pGH-IL-29 construct. PCR product digested with KpnI and SalI restriction
enzymes. This gene fragment was inserted into pLEXSYhyg 2 expression vector. In-silico SignalP assigns a probability of ~97% for cleavage of signal peptide between the
23rd and 24 th amino acids. Desired clone of transformed
E. coli was selected as described in materials and methods
(2.2) which had a PCR product of about 840 bp vs. clones
with 1300 bp-product which contained pLEXSY vectors
with re-ligated stuffr instead of desired insert (Figure 1 A). Plasmid extracted from this clone also subjected to
further confimation by digesting with PpumI enzyme
(Figure 1 B). Sequencing results revealed that IL-29 gene
segment was accurately amplifid and located in the correct position.

4.2. Transfection and Selection of Recombinant
I.L.L. Cells
Purifid pLEXSY - hyg2 – IL-29 was digested by Swa I and
the needless parts (ori and bla) were removed and a 5800
bp pure expression cassette was eluted from the gel to
further transfection. Stable transfectants in 100 µg.ml
-1 of hygromycin was subjected to DNA extraction and
checked for appropriate recombination of interest IL-29
gene in leishmania chromosomal 18 srRNA locus ( ssu ) by
PCR using F3001 and IL-29 reverse primers (Figure 2). 1850
bp PCR product reveals the successful integration of the
expressing cassette into leishmania ssu gene.
4.3. Expression Analysis of Recombinant IL-29
Expression of integrated recombinant IL-29 gene was
evaluated at both RNA and protein level. RT-PCR results
revealed that expected-size IL-29 was transcript and expressed (Figure 3). The presence of IL-29 protein was confimed by western blot analysis on cell lysate and culture
supernatant using specifi antibody for IL-29 protein.


Expected major encoded protein include signal peptide
and His-tag is about 23 kDa but 30 kDa and greater than
40 kDa isoforms were also observed in cell lysate but not
in culture supernatant (Figure 4) 4.4. Purifiation and Antiviral Assay of Recombinant IL-29
Purifiation of IL-29 was carried out by Ni - NTA His-bind
resin under denaturing conditions and preparation with
two major proteins with 23 and 30 kDa molecular weight
in SDS – PAGE, under reducing conditions. The fial protein yield was 0.075 mg.L -1 of the suspension culture.
Dose-response data obtained from antiviral assay were
plotted for purifid IL-29 (sample) and standard form
(control) (R&D systems, USA). The sample ED50 reached
to 25 ng.mL -1 which was 20% of standard activity with
ED50 of about 5 ng.mL -1 (Figure 5).
4.5. Glycosylation
The mobility of recombinant protein on SDS - PAGE after PNGase F treatment showed a small shift comparing
with untreated protein, which may be due to enzymatic
removal of N-glycans (Figure 6).


5. Discussion
In the last decade, many publications about IL-29 and
other interferon lambda family were presented. Although the combination of ribavirin and IFN-α2 has been
established as the standard treatment for patients with
chronic HCV infection but the hematologic and neurologic side effcts associated with this therapy are the main
problems. Since IFN type III receptors are not expressed
on all hematopoietic precursor cells, it has predicted to
have fewer side effcts (28, 29). For these reasons a phase
II clinical trial is ongoing. In addition IL-29 independent

ly has some antitumor activities and in cooperation with
type I IFN used for therapeutic purposes of some kinds of
tumors (5, 28, 30).
There are many other proteins were expressed in the
lexsy eukaryotic expression system (Jena Bioscience lexsy
host P10) or leishmania tarentolae (31, 32). In this study
we used Iranian Lizard leishmania parasite which isolated from Lizard species (Agama caucasica microlepis) in
Iran as an expression system for production od recombinant IL-29 for the fist time. The main advantages of the
leishmania expression system are as follows: (i) low-cost
growth condition, (ii) faster growth rate, (iii) human
safety, (iv) production of recombinant proteins and (v)
posttranslational modifiation of target proteins with a
mammalian - type N-glycosylation pattern and correctly
protein folding (33).
The expression cassette constructed in pLEXSY Hyg - 2
vector and inserted in the chromosomal location for
constitutive expression. In spite of protein production
in the cell lysate we could not detect secreted protein in
culture media which may be due to the lower effiency
of the signal peptide of secreted acid phosphatase 1 (SAP1)
of leishmania Mexicana in I.L.L. Secretion process may be
improved by changing of some amino acids in signal
peptide specifi positions (34).
In this study fial yield of protein was considered 0.075
mg.L -1 which was very low in comparison with other
proteins expressed in leishmania tarentolae (lexsy host P
10 of Jena bioscience) eukaryotic expression system. I.L.L
must be well characterized and its proteolytic enzymes
and their activity must be elucidated. On the other hand,
bioactivity of the purifid protein was 20% of utilizing
parallel standard which may be due to the purifiation
denaturing condition and restoration maybe are not
followed properly for most of the purifid proteins. Enzymatic removal of N-glycan on purifid recombinant
IL-29 revealed that glycosylation as one of the post translational modifiations is done at this expression system
as expected in eukaryotic systems.
In conclusion, we have expressed, purifid and characterized IL-29 (IFN-λ1) using pLEXSY – hyg 2 – IL-29 vector
in a new domestic leishmania host for the fist time. Easy
handling and culture of this eukaryotic host and mammalian cell like posttranslational modifiations are the
main advantages of this expression system. The protein
yield expression of this system is very low and it seems is
not economical for large-scale production.
Acknowledgements
There is no acknowledgment.
Authors’ Contribution
Amir Hossein Taromchi PhD Student carried out his thesis. The other authors were advisored and coworkered in
this research.
Financial Disclosure
We have no conflct of fiancial interests in this manuscript.
Funding/Support
This study was supported by the Deputy in Research of
Shahid Beheshti University of Medical Sciences through
grant No. 115-7861.








1. Samarajiwa Shamith A, Wilson William, Hertzog Paul J. Type I
Interferons: Genetics and Structure. The Interferons.Wiley-VCH
Verlag GmbH & Co. KGaA; 2006. p. 1-34.
2. Kotenko SV, Gallagher G, Baurin VV, Lewis-Antes A, Shen M, Shah
NK, et al. IFN-lambdas mediate antiviral protection through
a distinct class II cytokine receptor complex. Nat Immunol.
2003;4(1):69-77.
3. Sheppard P, Kindsvogel W, Xu W, Henderson K, Schlutsmeyer S,
Whitmore TE, et al. IL-28, IL-29 and their class II cytokine receptor
IL-28R. Nat Immunol. 2003;4(1):63-8.
4. Bekisz J, Schmeisser H, Hernandez J, Goldman ND, Zoon KC.
Human interferons alpha, beta and omega. Growth Factors.
2004;22(4):243-51.
5. Li M, Liu X, Zhou Y, Su SB. Interferon-lambdas: the modulators
of antivirus, antitumor, and immune responses. J Leukoc Biol.
2009;86(1):23-32.
6. Witte K, Witte E, Sabat R, Wolk K. IL-28A, IL-28B, and IL-29: promising cytokines with type I interferon-like properties. Cytokine
Growth Factor Rev. 2010;21(4):237-51.
7. Dumoutier L, Lejeune D, Hor S, Fickenscher H, Renauld JC. Cloning of a new type II cytokine receptor activating signal transducer and activator of transcription (STAT)1, STAT2 and STAT3.
Biochem J. 2003;370(Pt 2):391-6.
8. Lasfar A, Lewis-Antes A, Smirnov SV, Anantha S, Abushahba W,
Tian B, et al. Characterization of the mouse IFN-lambda ligandreceptor system: IFN-lambdas exhibit antitumor activity against
B16 melanoma. Cancer Res. 2006;66(8):4468-77.
9. Uze G, Monneron D. IL-28 and IL-29: newcomers to the interferon
family. Biochimie. 2007;89(6-7):729-34.
10. Platanias Leonidas C, Fish Eleanor N. Signaling pathways activated by interferons. Exp hematol. 1999;27(11):1583-1592.
11. Jordan WJ, Eskdale J, Boniotto M, Rodia M, Kellner D, Gallagher
G. Modulation of the human cytokine response by interferon
lambda-1 (IFN-lambda1/IL-29). Genes Immun. 2007;8(1):13-20.
12. Jordan WJ, Eskdale J, Srinivas S, Pekarek V, Kelner D, Rodia M, et al.
Human interferon lambda-1 (IFN-lambda1/IL-29) modulates the
Th1/Th2 response. Genes Immun. 2007;8(3):254-61.
13. Lasfar A, Abushahba W, Balan M, Cohen-Solal KA. Interferon
lambda: a new sword in cancer immunotherapy. Clin Dev Immunol. 2011;2011:349575.
14. Sato A, Ohtsuki M, Hata M, Kobayashi E, Murakami T. Antitumor
activity of IFN-lambda in murine tumor models. J Immunol.
2006;176(12):7686-94.
15. Doyle SE, Schreckhise H, Khuu-Duong K, Henderson K, Rosler R,
Storey H, et al. Interleukin-29 uses a type 1 interferon-like program to promote antiviral responses in human hepatocytes.
Hepatology. 2006;44(4):896-906.
16. Li M, He S. Purifiation and characterization of recombinant human interleukin-29 expressed in Escherichia coli. J Biotechnol.
2006;122(3):334-40.
17. Li MC, Wang HY, Li T, He SH. Liposome-mediated IL-28 and IL-29
expression in A549 cells and anti-viral effct of IL-28 and IL-29 on
WISH cells. Acta Pharmacol Sin. 2006;27(4):453-9.
18. Xie YF, Chen H, Huang BR. Expression, purifiation and characterization of human IFN-lambda1 in Pichia pastoris. J Biotechnol.
2007;129(3):472-80.

19. Breitling Reinhard, Klingner Susanne, Callewaert Nico, Pietrucha Regina, Geyer Anett, Ehrlich Gunter, et al. Non-pathogenic
trypanosomatid protozoa as a platform for protein research and
production. Protein Expr Purif. 2002;25(2):209-218.
20. Fritsche C, Sitz M, Weiland N, Breitling R, Pohl HD. Characterization of the growth behavior of Leishmania tarentolae: a new
expression system for recombinant proteins. J Basic Microbiol.
2007;47(5):384-93.
21. Mirzaahmadi S, Asaadi-Tehrani G, Bandehpour M, Davoudi N,
Tahmasbi L, Hosseinzadeh N, et al. Expression of recombinant
human coagulation factor VII by the Lizard Leishmania expression system. J Biomed Biotechnol. 2011;2011:873874.
22. Kazemi B. Isolation a lizard Leishmania promastigote from its
natural hostin Iran. J Biol Sci. 2004;4.
23. Beverley SM, Clayton CE. Transfection of Leishmania and Trypanosoma brucei by electroporation. Methods Mol Biol. 1993;21:333-48.
24. Robinson Kelly A, Beverley Stephen M. Improvements in transfection effiency and tests of RNA interference (RNAi) approaches in the protozoan parasite Leishmania. Mol Biochem Parasit.
2003;128(2):217-228.
25. Rotureau B, Gego A, Carme B. Trypanosomatid protozoa: a simplifid DNA isolation procedure. Exp Parasitol. 2005;111(3):207-9.
26. Meager A. Assays for antiviral activity. Methods Mol Biol.
2004;249:121-34.
27. Meager A, Visvalingam K, Dilger P, Bryan D, Wadhwa M. Biological
activity of interleukins-28 and -29: comparison with type I interferons. Cytokine. 2005;31(2):109-18.
28. Donnelly RP, Kotenko SV. Interferon-lambda: a new addition to
an old family. J Interferon Cytokine Res. 2010;30(8):555-64.
29. Pagliaccetti NE, Robek MD. Interferon-lambda in HCV Infection
and Therapy. Viruses. 2010;2(8):1589-602.
30. Fujie H, Tanaka T, Tagawa M, Kaijun N, Watanabe M, Suzuki T, et al.
Antitumor activity of type III interferon alone or in combination
with type I interferon against human non-small cell lung cancer.
Cancer Sci. 2011;102(11):1977-90.
31. Dortay H, Schmockel SM, Fettke J, Mueller-Roeber B. Expression of
human c-reactive protein in diffrent systems and its purifiation
from Leishmania tarentolae. Protein Expr Purif. 2011;78(1):55-60.
32. Sugino M, Niimi T. Expression of multisubunit proteins in Leishmania tarentolae. Methods Mol Biol. 2012;824:317-25.
33. Niimi T. Recombinant protein production in the eukaryotic protozoan parasite Leishmania tarentolae: a review. Methods Mol
Biol. 2012;824:307-15.
34. Klatt S, Konthur Z. Secretory signal peptide modifiation for optimized antibody-fragment expression-secretion in Leishmania
tarentolae. Microb Cell Fact. 2012;11:97.