Document Type : Research Paper
Author
Department of Soil Science, College of Agricultural, Ferdowsi University of Mashhad, P.O. Box 1163, Mashhad, I.R. Iran
Abstract
Keywords
INTRODUCTION
Among living organisms, there are certain genera of prokaryotes which are able to biologically fix nitrogen. The genus Bradyrhizobium is capable of nitrogen fixation and nodule formation in leguminous plants (Jordan, 1982). Most of these isolated strains are associated with nodules on Glycine spp. (Giongo et al., 2008; Sameshima et al., 2003; Zakhia and Lajudie 2001).
Nitrogen fixing bacteria, especially Bradyrhizobium and Rhizobium are of great importance in sustainable agriculture. Nowadays many different techniques are used for studying bacterial genetic diversity, especially that of rhizobial bacteria. Evaluation of bacterial plasmid profiles (number and size of plasmids) is an example of such techniques. However, Plasmid profiling is a time consuming procedure, the results of which are usually considered as morphological characteristics. Therefore, researchers do not use it as a routine method for genetic diversity studies (Shishido and Pepper 1990; Pepper et al., 1989). Multi locus enzyme electrophoresis (MLEE) is another technique for evaluating the genetic diversity of bacteria. This technique is based on the relative movement of intercellular enzymes. By using this method, different protein profiles can be produced which can reveal genetic relationships among different genera of bacteria (Wise et al., 1996 and 1995).
The amplification of 16S rRNA gene by using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the PCR products is also routinely used by many scientists for studying bacterial genetic diversity and their genetic relationships. A wide range of genes in accordance with the aim of research are used in the PCR/RFLP technique (Giongo et al., 2008). In the case of bacteria belonging to different genera with less genetic relatedness, amplification of only small parts of the 16S rRNA gene is performed (Herrera-Cervera et al., 1997). Intergenic spacer regions of the 16S-23S rRNA gene are generally used in the PCR/RFLP procedure for studying genetic diversity within a genus of bacteria (Willems et al., 2001). In recent years, this technique has extensively been used because of its good discriminative characteristics.
Another method is RFLP of different genes such as nif and nod, which are involved in nitrogen fixation and process of nodulation by Rhizobium and Bradyrhizobium bacteria. In this technique, the bacterial genome is hybridized by different probes and the resulting patterns are studied for the presence of genetic relationships among bacteria. The aim of this investigation was to design, use and evaluate sucA (alpha-ketoglutarate dehydrogenase gene consists of 2955 bp) and topA (topoisomerase gene consists of 2484 bp) probes for the purpose of revealing genetic relationships among a certain number of B. japonicum isolates.
MATERIALS AND METHODS
Bacterial isolates and DNA extraction: Eighteen isolates of Bradyrhizobium japonicum were obtained from Prof. Broomfield’s collection, Agriculture andAgri-Food (AAFC), Quebec, Canada. Small-scale preparations of total bacterial DNA were obtained by growing each isolate in 5 ml of tryptone yeast (TY) broth medium at 28ºC for 7 days.
Bacterial cell pellets of each individual isolate were obtained by spinning 2 ml of bacterial culture in eppendorf tubes at 4ºC, 9,750 ´g for 5 min. The pellets were then resuspended in 250 ml of resuspension buffer (50 mM Tris-Cl, pH 8; 10 mM EDTA). Resuspended cells were treated with 250 ml of lysis buffer (200 mM NaOH; 1% (w/v) SDS) and then mixed by inverting tubes until the solution became viscous and slightly clear. The resulting solution was then treated with 350 ml of neutralization buffer (3 M potassium acetate, pH 5.5) and centrifuged at 9,750 ´g for 10 min. The supernatant from each isolate was collected in a fresh tube and the extracted DNA was precipitated by adding isopropanol, followed by washing with 70% (v/v) ethanol. The DNA of each individual isolate was dried under vacuum and re-dissolved in 80 ml of TE buffer (pH 8) (Cullen and Hirsch, 1992).
PCR procedure: PCR reaction was performed as described by Williams et al. (1990), but with some modifications. The DNA amplification reaction wascarried out in a 50 ml volume containing: 5 ml of 10X PCR buffer, 1 ml of each dNTP (10 mM), 1 ml of each of the forward and reverse primers (5 mM) (sucA 5¢gagtggcaggagttcttca3¢ and 5¢gttcagcacccactccagata3¢, topA 5¢ttcaacgccatcaccaagc3¢ and 5¢ggcataggtcttctcgtgctt3¢), 41 ml of deionized water, 0.5 units of Taq DNA polymerase per reaction and 0.5 ml of the DNA sample. The thermal program for the PCR reactions was carried out by denaturation at 95ºC for 3 min followed by 35 cycles of denaturation at 95ºC for 1 min, annealing at 54ºC for 1 min, extension 72ºC for 2 min and a final cycle of extension at 72ºC for 3 minutes. The PCR products were analyzed on a 1.4% (w/v) agarose gel and visualized under ultraviolet light.
Digestion conditions: PCR products (10 ml) were digested in a reaction mixture consisting of 1.5 ml of specific buffer as recommended for each of the SacI and XhoI endonuclease enzymes, and 3.5 ml of deionized water and incubated at 37ºC for 3h. Digested PCR products were separated on a 2% (w/v) agarose gel running at 70 V, for 6 h.
Southern blotting: Bacterial genomic DNA was digested with SacI and separated by gel electrophoresis. The denatured DNA (by using 0.5 N NaOH and 1.5 M NaCl) was transferred from the electrophoresis gel to a nitrocellulose membrane. The DNA was then permanently attached to the nitrocellulose membrane by exposing to UV for 60 sec.
Hybridization: The Nitrocellulose membrane was incubated with the labeled probes (sucA and topA). Hybridization patterns were studied only after the removal of excess probe and poorly bound probe molecules, by washing briefly in 3×SSC/0.5% SDS.
RESULTS
PCR amplification of sucA and topA genes showed that the PCR reactions were carried out successfully. The PCR generated fragments were of the appropriate sizes and the intensity and purity of bands were acceptable (Fig. 1). The amplified fragment size of the sucA and topA genes were 2712 and 1869 bp, respectively.
The digestion of the PCR products of the sucA and topA genes, using the SacI enzyme, produced three (1267, 1104 and 341 bp, Lane 3) and five (212, 636, 266, 654 and 124 bp, Lane 4) fragments, respectively (Fig. 1). However, digestion of the same products with XhoI produced six (765, 691, 486, 338, 261 and 171 bp Lane 5) and four (918, 636, 213 and 104 bp Lane 6) fragments, respectively (Fig. 1).
A total of 18 SacI digested genomic DNA samples, belonging to the B. japonicum isolates are shown in Figure 2. The digested genomic DNA of the USDA110 strain as shown in lane 4 was selected as the reference strain, and the two sucA and topA probes were designed according to its DNA sequence . The results showed that the concentrations of genomic DNAs present in all lanes were similar, therefore making them suitable for the southern blot assay.
The hybridization patterns of the 18 totally digested genomic DNA samples of the B. japonicum isolates hybridized with the sucA and topA probes are shown in Figures 3 and 4, respectively. The insensitivity of bands in the case of sucA was higher than that when the topA probe was used. This was due to production of large fragments after digestion of sucA with the SacI enzyme.
DISCUSSION
Alpha-ketoglutarate dehydrogenase (sucA) and topoisomerase (topA) genes consist of 2955 bp (including 561A, 1005C, 907G, 482T), and 2484 bp (including 474A, 865C, 785G, 360T), respectively. Molecular weights of their two DNA strands are1822 and 1531 KD respectively. Four primers were designed by the DNAMAN software in order to amplify both genes. The PCR products of the sucA and topA were 2712 and 1869 bp. All fragments obtained from digestion of the PCR product of the two genes (using XhoI and SacI enzymes) were predicted by the DNAMAN software as shown in Figure 5. The in silico studies showed that when the sucA gene was digested by XhoI, 6 fragments were obtained. The sizes of these digested DNA fragments were 765, 691, 486, 338, 261 and 171 bp. When the sucA gene was digested by SacI, three fragments were produced and the sizes of fragments were 1267, 1104 and 341 bp (Fig. 5).
When the topA gene was digested by the XhoI enzyme, 4 fragments with sizes of 918, 636, 211 and 125 bp were obtained. When the topA gene was digested by SacI, five fragments were with sizes of 212, 636, 266, 654 and 124 bp were generated (Fig. 6).
The data show that digestion of the PCR products of the sucA and topA genes using SacI and XhoI produces three and five fragments (1267, 1104 and 341 bp, Lane 3, 212, 636, 266, 654 and 124 bp, Lane 4), and six and four fragments (765, 691, 486, 338, 261 and 171 bp, Lane 5, 918, 636, 213 and 104 bp, Lane 6), respectively. These results are in agreement with those obtained by the DNAMAN software. The lack of the complete clarity of the small fragments on the agarose gel in Figure 1 is due to the use of a low concentration of agarose gel during electrophoresis. Despite this, all the fragments can still be observed on the gel. Also, the digestion of topA gene with the sacI enzyme resulted in two fragments (approximately similar in size, 654, 636 bp) which can be seen on the gel as an intensive band.
With respect to the SacI cutting sites on the sucA probe, genomic DNA of the USDA110 strain was hybridized to 1.1, 1.7 and 2.1 kb fragments, as predicted by the DNAMAN software (Figs. 3 and 5). Similarly for the topA probe, genomic DNA of USADA110 was hybridized to 1.9, 6.4, 6.5 and 0.2 kb fragments (Figs. 4 and 6). In Figure 6, the intense hybridized band belongs to the 6.5 and 6.4 bp fragments. The two other hybridized bands (1.9 and 0.2 bp) display lower intensities.
Based on hybridization patterns of the sucA probe, 18 strains of B. japonicum can be categorized into 4 different groups. The isolates 1, 2, 3, 11 and 13 belong to group I and the isolates 4, 5, 6, 7, 8, 9, 14, 15, 16, 17 and 18 belong to group II. The isolates 12 and 10 belong to groups III and IV respectively (Fig. 3).
According to the hybridization patterns of the topA probe, 18 isolates of B. japonicum are categorized into 6 different groups. Group I includes the 1, 2, 3, 11 and 13 isolates. Group II is divided into two subgroups II-I that include 6, 4, 7 and 8 and group II-II that include the 5, 14, 15, 16, 17, and 18 isolates. The isolates 12, 10 and 9 are separately placed in groups III, IV and V, respectively (Fig. 6).
In comparison to the hybridization pattern obtained by the sucA probe, the pattern of the eighteen isolates of B. japonicum was completely different when hybridized by the topA probe. It can also be revealed that the diversity of organic base sequence in the topA probe among the Bradyrhizobium bacterial strains is higher than that of the sucA probe. The results of this study also show that designing different probes can be employed to study diversity among different prokaryotic genera, such as the rhizobial bacteria.
Acknowledgments
The author is grateful to the NSERC for awarding the scholarship to carry out research at AAFC Quebec, Canada, and also to Ferdowsi University of Mashhad for granting the unpaid leave. The author is extremely thankful to Professor Eden Bromfield who provided the B. japonicum isolates and to Professor Barren who provided assistance and valuable comments during all parts of the expriments.