Isolation, Identification, and Characterization of the Native Yeast Strains from Homemade Cheese to Assess their Eliminating Impact on the Aflatoxin B1 and M1 of the Simulated Gastrointestinal Fluid

Document Type : Research Paper

Authors

1 Department of food hygiene, science and research branch, Islamic Azad university, Tehran, Iran

2 Department of food science and technology, science and research branch, Islamic Azad university, Tehran, Iran

3 Department of Plant Sciences and Biotechnology, Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, Tehran, Iran.

Abstract

Background: The occurrence of aflatoxins in food products is a silent threat to human health worldwide. A range of strategies has been introduced to address the bioavailability of aflatoxins, which are considered microbial tools to provide a low-cost and promising approach.
Objectives: The present study focused on the separation of yeast strains from the homemade cheese rind layer to investigate the ability of native yeasts to eliminate AB1 and AM1 from simulated gastrointestinal fluids.
Material and Methods: Homemade cheese samples were prepared from different locations in Tehran provinces and yeast strains were isolated and identified through the biochemical methods and molecular analysis of internal transcribed spacer and D1/D2 domain of 26S rDNA regions. Isolated strains were screened using simulated gastrointestinal fluids, and the ability of yeast strains to absorb aflatoxin was evaluated.
Results: Out of 13 strains, 7 yeast strains were not affected by 5 ppm AFM1 while 11 strains did not show any significant response to 5 mg.L-1 (ppm) of AFB1. On the other hand, 5 strains were able to successfully tolerate 20 ppm AFB1. Candidate yeasts showed different abilities to remove aflatoxins B1 and M1. In addition, C. lusitaniae, G. geotrichum, G. candidum, and C. sanyaensis exhibited a significant ability to detoxify aflatoxins from the gastrointestinal fluid, respectively.
Conclusion: Our data suggest that yeast communities with essential effects on the quality of homemade cheese appear to be precise candidates for the potential elimination of aflatoxins from the gastrointestinal fluid.

Keywords

Main Subjects

1. Background

Aflatoxins belong to a group of polyketide-derived furanocoumarins that can contaminate a wide range of food products ( 1 ). There are many determinants and effectors such as meteorological and environmental factors, micro and macro, which cause the release of aflatoxin-producing fungi ( 2 ). AFB1 and AFM1 are classified as human carcinogenic secondary metabolites due to the formation of DNA adducts ( 3 ). The carcinogenicity and immunosuppression capacity of aflatoxin B1 (AFB1) causes a broad spectrum of disorders in livestock and human health worldwide. Due to the hydroxylation of AFB1, milk products are mainly contaminated by AFM1 and therefore milk plays an important role in transferring aflatoxins residing in human food ( 4 ). The health of more than 4.5 billion people is threatened by foodstuffs contaminated with various levels of aflatoxins ( 5 , 6 ). Previous studies have shown that the concentration of AFM1 in cheese can be up to 1.9 fold higher than the milk used to produce it ( 7 , 8 ).

The ripening and maturation process of fresh cheese reduced AFM1 concentration, which was inversely correlated with plate counts of lactic acid bacteria ( 9 ). Lactobacillus sp. plays a key role in the process of turning milk into yogurt by significantly reducing the level of AFM1 compared to its initial value in milk ( 10 ). Among the methods used to reduce the bioavailability of aflatoxins, microbial tools are a low-cost method and a promising strategy to eliminate these metabolites from food and feeds ( 11 ).

As mentioned earlier, the detoxification ability of yeast cells has been attributed to their cell wall composition ( 16 - 17 ). Some yeast strains such as Pichia kudriavzevii and Lachancea thermotolerans were able to act as biocontrol agents against aflatoxin-producing fungi ( 18 ) and others such as Saccharomyces cerevisiae could detoxify AFB1 ( 19 ).

In the present study, homemade cheese samples were collected from four different geographical areas of Tehran province. These regions have a long experience in producing homemade cheese from ewe milk called Liqvan cheese. Homemade cheeses are generally made from unpasteurized milk, which is affected by the natural microbiota of milk and the production environment, which plays an important role in preserving taste, aroma, and texture. After lactic acid bacteria, yeast species are the predominant microbiota in dairy products ( 20 ).

2. Objective

Therefore, this study focused on the natural yeast populations of cheese samples to find some isolates with relatively strong AFB1 and AFM1 detoxification capabilities.

3. Materials and Methods

3.1. Sample Collection

Homemade cheese samples were randomly prepared from four different geographical regions of Tehran province, including Shahriar, Garmsar, Firoozkooh, and Chetan cities, whose geographical characteristics are presented in Table 1. From each sampling location, eight pieces of 20- 25 days ripened cheese at 4 °C were sampled by scraping the rind surface with a sterile blade and the samples from each region were pooled and kept at a cool place and immediately transferred to the lab. The total fresh weight of the pooled samples was about 200g.

Location Rainfall (mm/year) Geographical profile Climate Altitude (m) Relative humidity (%)
N E
Firoozkooh 264.00 35°45’17.95” 52°46’20.48” Very cold and semi-humid 1975.5 67.00
Garmsar 71.32 35°13’54.30” 52°20’29.09” Warm and dry 856.0 30.12
Chetan 450.00 36°20’44.73” 51°28’3.75” Mid weather and humid 1500.0 79.00
Shahriar 279.10 35°40’14.44” 51° 1’21.93” Cold and semi-dry 1140.0 59.91
Table 1.Climate and geographical features of cheeses sampling sites. These are selected from different climatic and geographic regions to probably show the effect of regional parameters on yeast populations and characteristics.

3.2. Yeast Isolation

Yeast isolation was performed based on Yalcin and Ucar’s studies with some modifications ( 21 ). In summary, homemade cheese samples (3 g) were placed in 20 mL of peptone water (0.1%) medium and homogenized. Then decimal dilutions were prepared and cultured in plates containing Chloramphenicol Yeast Glucose Agar (CYG) (20 g.L-1 dextroses, 5.0 g.L-1 yeast extract, 0.1 g.L-1 chloramphenicol, 14.9 g.L-1 agar, pH: 6.9 ± 0.2) (Sigma). The plates were then incubated at 30 °C for five days. The growth of microorganisms was monitored every 24 hours. Colonies with distinct morphologies were selected and purified on CYG medium by streaking method. Finally, the purified strains were kept at 4 °C for further investigation.

3.3. Polymerase Chain Reaction

The purified strain’s DNA extraction was processed through the Higher Purity Yeast Genomic DNA Extraction kit (Canvax) according to manufacturer instructions. To distinguish yeasts from other isolates, ITS1-5.8S rDNA-ITS4 (internal transcribed spacer) region was amplified ( 21 ). Primers for the ampli-fication were ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC). The DNA was amplified in a 25 μL reaction mixture containing 5 ng extracted DNA, 1.5 U Taq DNA polymerase, 0.5 μM each of primers, 1.6 mM dNTPs, 20 mM Tris-HCl (pH 8.8), 1.5 mM MgCl2, and 50 mM KCl. The PCR conditions were as follows: initial denaturation at 95 °C for seven min, followed by 35 cycles of denaturation at 94 °C for 30 min, 54 °C for one min, extension at 72 °C for two min, and final stage at 72 °C for five min in a thermal cycler (Eppendorf). The DNA fragments were separated by 1.5% agarose gel electrophoresis staining with erythrogel and visualized with a transilluminator.

3.4. Amplification of D1/D2 Domain of 26S rDNA Region

Identification of yeast isolates was carried out by amplifying and analyzing the sequences of the D1/D2 region of the 26S rDNA encoding gene using the primers NL1 (GCATATCAAT AAGCGGAGGAAAAG) and NL4 (GGTCCGT GTTTCAAGACGG). The amplification mixture was prepared as abovementioned and the amplification condition was as follows: initial denaturation at 94 °C for 2 min, followed by 40 cycles of denaturation at 95 °C for 45 s, annealing at 55 °C for 45 s, extension 72 °C for 35 s, and a final stage of extension 72 °C for 10 min ( 22 ). Amplified DNA fragments were purified using a QIAEXII Gel extraction kit (QIAGEN), and their nucleic acid sequence was determined at the DNA Sequencing Service of Pishgam Bio-Tech (Tehran, Iran). The DNA sequences were checked through the BLASTN program of The National Center for Biotechnology database (www.ncbi.nlm.nih.gov/BLAST) and were analyzed using MEGA 7 software ( 23 ).

3.5. Preparation of Aflatoxin Stock Solution

AFB1 and AFM1 standard solutions (10 µg.mL-1) were purchased from Faroogh Life Sciences Research Laboratory, Iran. To prepare the stock solution, the standards were dissolved in benzene: acetonitrile (98:2 v/v) ( 24 - 25 ). The stock solution was stored in an amber glass at 4 °C until use.

3.6. Screening of Yeast Isolates

The medium used in shake flask assays was CYG broth. Fifty mL of the medium-plus 5, 10, and 20 ppm aflatoxin B1 and 5 ppm aflatoxin M1 were added to 250 mL Erlenmeyer flasks. The experiment was performed in five replications. In each flask, 1012 cells of each yeast strain were inoculated and immediately incubated at 37 °C and shaken at 120 rpm. Chloramphenicol Yeast Glucose Agar was used for the isolation and enumeration of yeast cells.

3.7. Preparation of Digestive Fluids

Simulated stomach fluid containing 1.2 g.L-1 sodium bicarbonate, 2.2 g.L-1 potassium chloride, 6.2 g.L-1 sodium chloride, 0.22 g.L-1 calcium chloride and 0.3% pepsin and intestinal fluid containing 0.45% bile salt, 5 g.L-1 sodium chloride, 0.3 g.L-1 calcium chloride, 0.6 g.L-1 potassium chloride and 0.1% pancreatin were prepared and sterilized by filtration of 0.2 μm. Stomach and intestinal fluid pH was adjusted to 2.5 and 7.5 using hydrochloric acid 0.1 N and 0.1 N sodium hydroxide solutions (Sigma), respectively.

3.8. Aflatoxin Removal Assessment

Four candidate yeast strains were cultured separately in fluids prepared to simulate gastric conditions. In the first step, 1×1010 yeast cells were added to 10 mL of simulated stomach fluid contaminated with 5 ppm AFB1 or AFM1, vortexed for 15 s, and incubated for two hours at 37 °C. Next, one milliliter of the resulting fluid was added to nine mL of simulated intestinal fluid, vortexed, and incubated for two hours at 37 °C. Finally, each sample was centrifuged at 12000 g for 15 min and the amount of aflatoxin remaining in the supernatant solution was determined. The result was considered to calculate the ability of yeast strains to absorb aflatoxin compared to the amount of aflatoxin in the control solution.

3.9. Quantification of Aflatoxins

ELISA kits AFB1 and AFM1 (R-Biopharm; Darmstadt, Germany) were used to detect the amount of AFB1 and AFM1 content of solutions as previously described ( 19 ). Quantitative analysis was performed by competitive enzymatic immunoassay. To determine the residual aflatoxin, different concentrations (0, 1, 5, 10, 20, and 50 ng.mL-1) of standard AFB1 and AFM1 solutions were prepared. Aflatoxin standards and samples were then repeatedly added to microtiter plate wells precoated with antibodies against AFB1 and AFM1 and incubated at 25 °C in the dark for half an hour. Then 50 μL of anti-aflatoxin antibodies and enzymatically conjugated solution were added to the wells and incubated at 25 °C for one hour in a dark place. The washing step removed the unbound conjugate and then 50 μL of each substrate and chromogen were added to the wells. The plates were incubated in the dark at 25 °C for 15 minutes and finally, the process was stopped by adding 100 μL of stop solution, and the absorbance was measured at 450 nm on an ELISA plate reader (Bio Tek ELx800, USA).

3.10. Statistical Analysis

The distance matrices of the identified yeast isolates were performed using the UPGMA method (Unweighted Pair Group Method with Arithmetic mean) available at ( 26 ). Dendrograms were visualized with MEGA7 software. Data analysis was performed using a Statistical Package for Social Sciences (SPSS) version 18.0. Comparison of multiple means and analysis of variance between all samples was performed using one-way analysis of variance (ANOVA) and Fisher’s least significant difference (LSD) test, respectively. Quantitative data were expressed as mean ± standard error of the mean (SEM) of four independent tests. All experiments were performed in four replicates unless otherwise stated.

4. Results

4.1. Climate and Geographical Features of Sampling Sites

As shown in Table 1, Firoozkooh is the highest in terms of altitude and Garmsar is placed in the lowest region. Garmsar is a representative of the semi-desert regions of Iran and Chetan has a mid-weather and humid climate. Shahriar is a region with an approximate average of geographical features among the sampling sites studied. As shown in Figure 1, all sampling sites are in the northern region of Iran, therefore it is expected that the significant difference in the climatic feature of the sampling sites is due to topographic cues.

Figure 1.Homemade cheeses sampling sites around Tehran province in Iran. The circles were indicated 1: Shahriar, 2: Chetan, 3: Garmsar, 4: Firoozkooh and star shape were showed the center of Tehran province.

4.2. Yeast Isolation, Identification, and Characterization

Cheese layers were collected, and yeast strains were isolated using CYG media. In total, 13 isolates were obtained from 4 different cheese samples. The sequences D1/D2 and ITS domains of 26S rDNA gene were analyzed for identification of the isolated yeasts as described by Knutsen et al ( 28 ) (Fig. 2A). Our results showed that D1/D2-PCR resulted in a single fragment of 610 bp, which means that all isolates are yeast ( 22 ). ITS region sequencing has been used repeatedly to isolate and identify yeasts in dairy products, wine, and other foods ( 29 ) ( 30 ) ( 31 ). Electrophoresis of ITS region PCR products provided different visual bands from 360 to 880 bp. The largest DNA fragment was produced by isolating Saccharomyces cerevisiae while the smallest fragment produced by isolating Galactomyces geotrichum and Geotrichum candidum. Based on the presented results, Candida sanyaensis and Calvispora lusitaniae isolates produced 500 and 400 bp fragments and Debaryomyces hansenii isolates produced 610 bp fragments in length (Fig. 2B).

Figure 2.Analysis of D1/D2 and ITS domains of 26S rDNA gene of the isolated yeasts.A) Amplification of D1/D2 domain of 26S rDNA region. Lane M: DNA ladder (100 bp). Lines 1 to 13 presented different yeast strains (610 bp). Line 14: negative control. B) PCR products of the ITS regions of different yeast isolates. Lane M: DNA ladder (100 bp). Lines 1, 6, 7, and 8: Debaryomyces hansenii strains. Line 2: Candida sanyaensis. Lines 3, 4, and 5: Candida zeylanoides strains. Line 9: Calvispora lusitaniae. Line 10: Saccharomyces cerevisiae. Lines 11 and 13: Galactomyces geotrichum strains. Line 12: Geotrichum candidum. Lane 14: negative control.

The D1/D2 sequence of each isolate was analyzed and compared with the homolog sequences in the NCBI databases. Sequence alignment of yeast strains showed that twelve yeast strains had a homology score higher than 95% (Table 2). The identified yeast isolates belonged to 6 and 7 different genera and species, respectively.

Lane No. Yeast code Alignment results GenBank information
Recommended strain Accession No. Homology (%) Accession No. Strain Name
1 FI1 D. hansenii KY512397.1 97.60 OK184810.1 SBU1
2 FI2 C. sanyaensis MK110136.1 98.45 OK184817.1 SBU5
6 CI1 D. hansenii KY512103.1 99.83 OK184811.1 SBU2
12 CI2 G. candidum MT151654.1 95.49 OK184515.1 SBU11
7 CI3 D. hansenii MK358164.1 99.65 OK184512.1 SBU3
10 CI4 S. cerevisiae HM101472.1 99.32 OK184514.1 SBU10
11 CI5 G. geotrichum JF262195.1 98.34 OK184516.1 SBU12
5 CI6 C. zeylanoides MF462796.1 98.92 OK184519.1 SBU6
9 GI1 C. lusitaniae KY106929.1 91.90 OK184518.1 SBU9
4 GI2 C. zeylanoides MF462810.1 99.65 OK184520.1 SBU7
8 SI1 D. hansenii KY512185.1 99.83 OK184513.1 SBU4
13 SI2 G. geotrichum JF262196.1 99.28 OK184522.1 SBU13
3 SI3 C. zeylanoides MT422087.1 98.67 OK184521.1 SBU8
Table 2.Identification of yeast strains based on homology analysis of D1/D2 domain sequence.

To determine the evolutionary position of yeast strains, all sequences were used to construct a phylogenetic tree according to the UPGMA method. As shown in Figure 3, 3 clade clusters were formed with different members. The biggest cluster consisted of 9 yeast strains from 3 genera. 3 strains of Debaryomyces hansenii along with 2 out of 3 strains of Candida zeylanoides were classified in the same group. On the other hand, 2 strains of Galactomyces geotrichum were placed in the same class. Candida sanyaensis, Saccharomyces cerevisiae, and Geotrichum candidum made a cluster, and Candida zeylanoides and Calvispora lusitaniae made a distinct class of phylogeny. According to the phylogenetic tree, the earliest ancestral roots of the yeast strains had confidence levels greater than 99% which means there were high-confidence evolutionary relationships in the same clade cluster.

Figure 3.The estimation of phylogenetic relatedness among 13 different yeast isolates was determined using UPGMA statistical method with 1000 bootstrap replications. The substitution model was a maximum composite likelihood. Numbers are bootstrap values as confidence level.

There were two strains, D. hansenii and C. zeylanoides, which showed a higher occurrence in homemade cheese samples (Table 3). Yeast strain, D. hansenii was absent in the Garmsar cheese samples while C. zeylanoides did not find in the Firoozkooh samples. The relative optimum temperature was 28 °C for yeast strains while the optimum pH showed a big variation among strains. The optimum amount of pH and temperature did not demonstrate any correlation with sampling locations.

Sampling site Location code Optical Density at different temperature and pH levels CFU (mL)
°C at optimum pH pH at 28 °C
20 25 28 37 3.5 4.5 5.5 6.0 6.5
Firoozkooh FI1 0.38 0.54 0.62 0.42 0.38 0.45 0.35 0.34 0.35 7.8(107)
FI2 0.15 0.36 0.21 0.23 0.15 0.61 0.31 0.40 0.23 3.7(107)
Chetan CI1 0.50 0.88 0.92 0.91 0.50 0.41 0.40 0.50 0.71 4(107)
CI2 0.51 0.97 0.91 0.82 0.51 0.35 0.40 0.56 0.61 4(109)
CI3 0.29 1.00 1.01 1.07 0.29 0.22 0.22 0.21 0.24 4.9(106)
CI4 0.50 1.00 1.01 1.05 0.50 0.44 0.26 0.27 0.26 9.4(108)
CI5 0.50 1.07 1.05 1.17 0.50 0.38 0.35 0.53 0.53 5.3(108)
CI6 0.57 1.03 0.87 1.03 0.57 0.46 0.52 0.57 0.63 8.3(105)
Garmsar GI1 0.20 0.38 0.44 0.25 0.20 0.29 0.23 0.25 0.27 3.8(108)
GI2 0.29 0.89 0.86 0.86 0.29 0.49 0.42 0.57 0.33 3.6(109)
Shahriar SI1 0.72 0.35 0.46 0.31 0.52 0.68 0.64 0.76 0.74 3.9(109)
SI2 0.76 0.86 0.95 1.01 0.76 0.83 0.61 0.76 0.77 5.7(108)
SI3 0.64 1.02 1.00 0.93 0.64 0.76 0.63 0.71 0.72 3.1(1010)
SI4 0.44 0.74 0.66 0.52 0.38 0.45 0.35 0.34 0.35 9.8(109)
Table 3.Optimization of media pH and Temperature for yeast strains

4.3. Yeast Strains’ Responsiveness to Aflatoxins

Of the 13 strains, 5 strains were able to successfully tolerate 20 ppm AFB1. On the other hand, 7 strains of yeast had no effect on 5 ppm AFM1 while 11 strains did not show any significant response to 5 ppm AFB1. As shown in Table 4, aflatoxin M1 strongly inhibits yeast growth relative to aflatoxin B1. Four strains of D. hansenii illustrated large differences in response to AFM1 while all of them were strongly captured by AFTB1 at 20 ppm. Unlike D. hansenii, the C. zeylanoides strain did not follow the path of D. hansenii. To evaluate the ability of aflatoxin removal of candidate yeasts in simulated gastrointestinal conditions, 3 indicators were considered. First, the highest mean value and the lowest standard deviation were calculated with the growth rate under aflatoxin treatments (Table 4) and then the candidate species should not be repeated among other candidates.

Location code Strain Name AFB1 (ppm) AFM1 (ppm) Ave. Std.
5 10 20 5
24 48 24 48 24 48 24 48
FI1 D. hansenii 100 100 100 100 50 63 50 46 76 26
FI2 C. sanyaensis 93 97 123 114 117 100 65 67 97 22
CI1 D. hansenii 0 71 0 100 20 44 100 127 58 49
CI2 G. candidum 94 111 175 100 103 111 100 125 115 26
CI3 D. hansenii 0 71 0 125 20 33 136 106 61 56
CI4 S. cerevisiae 100 107 100 100 85 71 111 133 101 18
CI5 G. geotrichum 88 100 100 100 90 100 121 97 100 10
CI6 C. zeylanoides 100 107 100 97 50 46 5 63 71 36
GI1 C. lusitaniae 100 100 104 100 88 95 90 63 93 13
GI2 C. zeylanoides 100 139 625 130 100 79 91 86 169 186
SI1 D. hansenii 0 100 0 100 40 56 74 90 58 41
SI2 G. geotrichum 100 109 100 100 110 120 133 160 117 21
SI3 C. zeylanoides 80 125 625 115 81 53 106 116 163 189
Table 4.Growth response of yeast strains to different concentrations of AFB1 (5, 10, and 20 ppm) and AFM1 (5 ppm) in comparison with control conditions during two-time points (24 and 48 hours). Growth of yeast under control conditions was considered 100 percent and according to that growth under aflatoxin, treatments were calculated. As Fisher’s least significant difference procedure, the smallest significant difference between the two means was 23.5.

Candidate yeast strains exhibited different removal abilities for aflatoxins B1 and M1 (Fig. 4). Despite the yeast growth response to AFB1 (Table 4), there was a significant difference among all candidate strains in their ability in simulated gastrointestinal conditions. C. lusitaniae and C. sanyaensis strains illustrated the lowest and highest removal ability, respectively. In addition, the removal ability of C. lusitaniae, G. geotrichum and G. candidum was remarkable against AFB1. On the other hand, the reaction of the yeast strains to AFM1 was completely different and C. sanyaensis and C. lusitaniae showed the highest inhibitory potential against AFM1. Furthermore, G. candidum showed a noteworthy performance in removing AFM1 from the gastrointestinal fluid.

Figure 4.Assessment of the binding ability of yeast isolates against 5 ppm aflatoxin M1 and B1 in simulated gastrointestinal conditions.

5. Discussion

Climatic and geographical parameters are among the main natural driving forces that can create the pressure of effective selection for the formation of native microbial communities in each region. Cheese production is adapted to different environmental conditions ( 27 ) and as a result, microbial communities of cheese are strongly influenced by climatic conditions and geographical features. In this study, homemade cheese samples were collected from different places that have experienced different climatic and geographical conditions. As reported, the highest prevalence of the yeast species on the cheese rind was belong to Debaryomyces hansenii and Geotrichum candidum ( 32 ) and also Penicillium roqueforti and Debaryomyces hansenii ( 33 ). As expected from previous studies, the evaluation of yeast diversity of the homemade cheeses along with different ecological behaviors of yeast isolates from the same species strongly highlighted the influence of the local manufacturing process on the yeast diversity and ecology of the cheeses ( 34 ) ( 35 ) ( 20 ).

According to previous studies on aflatoxin contamina-tion in Iranian dairy products ( 36 ) ( 37 ) ( 38 ), cheese is one of the main products with the highest rate of aflatoxin contamination. On the other hand, it seems that the natural yeast population of cheese surfaces can play a decisive role in reducing the destructive effect of aflatoxins. In this study, evaluation of the response of yeast strains showed different growth responses to different concentrations of aflatoxins.

Previous studies have shown that aflatoxin binding to the polysaccharide part of its cell wall is a physical phenomenon that occurs on the surface of yeast ( 39 ). Shetty et al, observed that 75% of the binding strength of yeast is related to substances extracted from the cell wall ( 40 , 41 ). Zhou et al research indicated that binding to the cell wall was the main reason for the detoxification of aflatoxin B1 by Zygosaccharomyces rouxii and Streptococcus thermophilus in liquid fermentation. The amount of aflatoxin bound by these two microorganisms was more than 50% ( 42 ). These data seem to be in line with the findings of this study because the isolated yeast strains retained the ability to absorb aflatoxin even after being killed.

In another study, Hamad et al investigated the reduction of aflatoxin in milk with a combination of probiotic bacteria and yeast strains and showed that the combination of Saccharomyces cerevisiae yeast strains with probiotic Lactobacillus Plantarum, Lactobacillus acidophilus, Bifidobacterium bifidum, Kluyveromyces lactis can significantly reduce the amount of aflatoxin M1 in milk ( 25 ). Similar to our findings, yeast strains were able to reduce both AFB1 and AFB2; 54% with S. cerevisiae and 42% with K. lactis. The minimal difference in the percentage of aflatoxin reduction can be attributed to the aflatoxin absorption mechanism and the binding capacity of yeasts to these toxins.

6. Conclusions

All geographical samples of homemade cheeses comprise different yeast isolates with distinct diverse biological characteristics. Some species of yeast, D. hansenii, and C. zeylanoides, despite their extensive ecological presence, show extensive growth changes against aflatoxins. On average, candidate yeast strains did not have a negative effect on different aflatoxin concentrations and successfully removed AFB1 and AFM1 from gastrointestinal fluid in the range of 25 to 50%. Yeast communities appear to provide accurate candidates for potential aflatoxin removal from the gastrointestinal fluid, with a significant impact on the quality of homemade cheese.

Acknowledgment

We would like to show our gratitude to the Hell Fork Company for funding this study through grant number 140010090920.

References

  1. Udomkun P, Wiredu AN, Nagle M, Müller J, Vanlauwe B, Bandyopadhyay R. Innovative technologies to manage aflatoxins in foods and feeds and the profitability of application–A review. Food Control. 2017; 76:127-138. DOI
  2. Marchese S, Polo A, Ariano A, Velotto S, Costantini S, Severino L. Aflatoxin B1 and M1: Biological properties and their involvement in cancer development. Toxins. 2018; 10:214. DOI
  3. Logrieco AF, Miller JD, Eskola M, Krska R, Ayalew A, Bandyopadhyay R, Battilani P, Bhatnagar D, Chulze S, De Saeger S. The mycotox charter: increasing awareness of, and concerted action for, minimizing mycotoxin exposure worldwide. Toxins. 2018; 10:149. DOI
  4. Nguyen T, Flint S, Palmer J. Control of aflatoxin M1 in milk by novel methods: A review. Food Chem. 2020; 311:125984. DOI
  5. Mollayusefian I, Ranaei V, Pilevar Z, Cabral-Pinto MM, Rostami A, Nematolahi A, Khedher KM, Fakhri Y, Khaneghah AM. The concentration of aflatoxin M1 in raw and pasteurized milk: A worldwide systematic review and meta-analysis. Trends in Food Sci Technol. 2021. DOI
  6. Salari N, Kazeminia M, Vaisi-Raygani A, Jalali R, Mohammadi M. Aflatoxin M1 in Milk Worldwide from 1988 to 2020: A Systematic Review and Meta-Analysis. J Food Qual. 2020. DOI
  7. Costamagna D, Gaggiotti M, Chiericatti C, Costabel L, Audero GMdL, Taverna M, Signorini M. Quantification of aflatoxin M1 carry-over rate from feed to soft cheese. Toxicol Rep. 2019; 6:782-787. DOI
  8. Iha MH, Barbosa CB, Okada IA, Trucksess MW. Aflatoxin M1 in milk and distribution and stability of aflatoxin M1 during production and storage of yoghurt and cheese. Food Control. 2013; 29:1-6. DOI
  9. Chavarría G, Molina A, Leiva A, Méndez G, Wong-González E, Cortés-Muñoz M, Rodríguez C, Granados-Chinchilla F. Distribution, stability, and protein interactions of Aflatoxin M1 in fresh cheese. Food Control. 2017; 73:581-586. DOI
  10. Govaris A, Roussi V, Koidis P, Botsoglou N. Distribution and stability of aflatoxin M1 during production and storage of yoghurt. Food Add Contam. 2002; 19:1043-1050. DOI
  11. Khadivi R, Razavilar V, Anvar S, Akbari-Adergani B. Aflatoxin M1-binding ability of selected lactic acid bacteria strains and Saccharomyces boulardii in the experimentally contaminated milk treated with some biophysical factors. Arch Razi Ins. 2020; 75:63. DOI
  12. Sokoutifar R, Razavilar V, Anvar AA, Shoeiby S. Degraded aflatoxin M1 in artificially contaminated fermented milk using Lactobacillus acidophilus and Lactobacillus plantarum affected by some bio-physical factors. J Food Saf. 2018; 38:e12544. DOI
  13. Guan Y, Chen J, Nepovimova E, Long M, Wu W, Kuca K. Aflatoxin Detoxification Using Microorganisms and Enzymes. Toxins. 2021; 13:46. DOI
  14. Gonçalves BL, Rosim RE, Oliveira CAF, Corassin CH. The in vitro ability of different Saccharomyces cerevisiae–based products to bind aflatoxin B1. Food Control. 2015; 47:298-300. DOI
  15. Gonçalves BL, UlianaL RD, Coppa CFSC, Lee SHI, Kamimura ES, Oliveira CAF, Corassin CH. Aflatoxin M1: biological decontamination methods in milk and cheese. Food Sci Technol. 2020. DOI
  16. Ringot D, Lerzy B, Chaplain K, Bonhoure J-P, Auclair E, Larondelle Y. In vitro biosorption of ochratoxin A on the yeast industry by-products: comparison of isotherm models. Bio Technol. 2007; 98:1812-1821.
  17. García-Béjar B, Árevalo-Villena M, Briones A. Characteri-zation of yeast population from unstudied natural sources in La Mancha region. J Appl Microbiol. 2021; 130:650-664. DOI
  18. Moradi M, Rohani M, Fani SR, Mosavian MTH, Probst C, Khodaygan P. Biocontrol potential of native yeast strains against Aspergillus flavus and aflatoxin production in pistachio. Food Add Contam Part A. 2020; 37:1963-1973. DOI
  19. Zolfaghari H, Khezerlou A, Ehsani A, Khosroushahi AY. Detoxification of Aflatoxin B1 by Probiotic Yeasts and Bacteria Isolated From Dairy Products of Iran. Adv Pharm Bull. 2020; 10:482. DOI
  20. Golić N, Čadež N, Terzić-Vidojević A, Šuranská H, Beganović J, Lozo J, Kos B, Šušković J, Raspor P, Topisirović L. Evaluation of lactic acid bacteria and yeast diversity in traditional white pickled and fresh soft cheeses from the mountain regions of Serbia and lowland regions of Croatia. Int J Food Microbiol. 2013; 166:294-300. DOI
  21. Yalcin HT, Ucar FB. Isolation and characterization of cheese spoiler yeast isolated from Turkish white cheeses. Ann of Microbiol. 2009; 59:477-483.
  22. Hesham AE-L, Wambui V, JO HO, Maina JM. Phylogenetic analysis of isolated biofuel yeasts based on 5. 8 S-ITS rDNA and D1/D2 26S rDNA sequences. J Genet Eng Biotechnol 2014; 12:37-43. DOI
  23. Hesham A, Alrumman S, Al-Dayel M, Salah H. Screening and genetic identification of acidic and neutral protease-producing yeasts strains by 26S rRNA gene sequencing. Cytol Genet. 2017; 51:221-229. DOI
  24. Aazami MH, Nasri MHF, Mojtahedi M, Mohammadi SR. In Vitro Aflatoxin B1 Binding by the Cell Wall and (1→ 3)-β-d-Glucan of Baker’s Yeast. J Food Protect. 2018; 81:670-676. DOI
  25. Hamad GM, Zahran E, Hafez EE. The efficacy of bacterial and yeasts strains and their combination to bind aflatoxin B1 and B2 in artificially contaminated infants food. J Food Safe. 2017; 37:e12365. DOI
  26. Csoma H, Kállai Z, Antunovics Z, Czentye K, Sipiczki M. Vinification without Saccharomyces: Interacting Osmotolerant and “Spoilage” Yeast Communities in Fermenting and Ageing Botrytised High-Sugar Wines (Tokaj Essence). Microorganisms. 2021; 9:19. DOI
  27. Irlinger F, Layec S, Hélinck S, Dugat-Bony E. Cheese rind microbial communities: diversity, composition and origin. FEMS Microbiol Lett. 2015; 362:1-11. DOI
  28. Knutsen AK, Robert V, Poot G, Epping W, Figge M, Holst-Jensen A, Skaar I, Smith MT. Polyphasic re-examination of Yarrowia lipolytica strains and the description of three novel Candida species: Candida oslonensis sp. nov., Candida alimentaria sp. nov. and Candida hollandica sp. nov. Int Sys Evol Microbiol. 2007; 57:2426-2435. DOI
  29. Fernández-Espinar MT, Esteve-Zarzoso B, Querol A, Barrio E. RFLP analysis of the ribosomal internal transcribed spacers and the 5.8 S rRNA gene region of the genus Saccharomyces: a fast method for species identification and the differentiation of flor yeasts. ALJMAO. 2000; 78:87.
  30. Martin CE, Oh C-S, Jiang Y. Regulation of long chain unsaturated fatty acid synthesis in yeast. Biochimica et Biophysica Acta (BBA)-Molecular and Cell Biology of Lipids. 2007; 1771:271-285. DOI
  31. Petersen KM, Møller PL, Jespersen L. DNA typing methods for differentiation of Debaryomyces hansenii strains and other yeasts related to surface ripened cheeses. Int J Food Microbiol. 2001; 69:11-24. DOI
  32. Fröhlich-Wyder MT, Arias-Roth E, Jakob E. Cheese yeasts. Yeast. 2019; 36:129-141. DOI
  33. Onmaz NE, Gungor C, Al S, Dishan A, Hizlisoy H, Yildirim Y, Tekinsen FK, Disli HB, Barel M, Karadal F. Mycotoxigenic and phylogenetic perspective to the yeasts and filamentous moulds in mould-matured Turkish cheese. Int J Food Microbiol. 2021; 357:109385. DOI
  34. Renye Jr J, Somkuti G, Van Hekken D, Prieto VG. Characterization of microflora in Mexican Chihuahua cheese. J Dairy Sci. 2011; 94:3311-3315. DOI
  35. Lavoie K, Touchette M, St-Gelais D, Labrie S. Characterization of the fungal microflora in raw milk and specialty cheeses of the province of Quebec. Dairy Sci Technol. 2012; 92:455-468. DOI
  36. Mohajeri FA, Ghalebi SR, Rezaeian M, Gheisari HR, Azad HK, Zolfaghari A, Fallah AA. Aflatoxin M1 contamination in white and Lighvan cheese marketed in Rafsanjan, Iran. Food Control. 2013; 33:525-527. DOI
  37. Shahbazi Y, Nikousefat Z, Karami N. Occurrence, seasonal variation and risk assessment of exposure to aflatoxin M1 in Iranian traditional cheeses. Food Control. 2017; 79:356-362. DOI
  38. Tavakoli HR, Riazipour M, Kamkar A, Shaldehi HR, Nejad ASM. Occurrence of aflatoxin M1 in white cheese samples from Tehran, Iran. Food Control. 2012; 23:293-295. DOI
  39. Campagnollo FB, Khaneghah AM, Borges LL, Bonato MA, Fakhri Y, Barbalho CB, Barbalho RL, Corassin CH, Oliveira CA. In vitro and in vivo capacity of yeast-based products to bind to aflatoxins B1 and M1 in media and foodstuffs: a systematic review and meta-analysis. Food Res Int. 2020; 137:109505. DOI
  40. Shetty PH, Hald B, Jespersen L. Surface binding of aflatoxin B1 by Saccharomyces cerevisiae strains with potential decontaminating abilities in indigenous fermented foods. Int J Food Microbiol. 2007; 113:41-46. DOI
  41. Shetty PH, Jespersen L. Saccharomyces cerevisiae and lactic acid bacteria as potential mycotoxin decontaminating agents. Trend Food Sci Technol. 2006; 17:48-55. DOI
  42. Zhou G, Chen Y, Kong Q, Ma Y, Liu Y. Detoxification of aflatoxin B1 by Zygosaccharomyces rouxii with solid state fermentation in peanut meal. Toxins. 2017; 9:42. DOI
Iranian Journal of Biotechnology
Volume 21, Issue 2
April 2023
Pages 95-104

Files

Share

How to cite

Statistics