Phenotype Compensation in Reproductive ADAM Gene Family: A Case Study with ADAM27 Knockout Mouse

1. Background

A disintegrin and metalloproteinase (ADAM) has been reported in a wide range of organisms. At least 40 members of the ADAM family have been identified in chromosomes in different cells. Most ADAMs have a preserved structure that comprises several domains. The disintegrin ADAM domain contains motifs that bind to integrin receptors in target cells ( 1 ). Integrin receptors are heterodimer cell membrane proteins that play a critical role in cell-cell and cell-matrix interactions ( 2 ). There are cysteine-rich and EGF-like domains in the ADAM protein structure that contribute to the recognition and binding of specific substrates ( 3 ). Some cysteine-rich ADAM domains contain virus-like fusion peptide sequences and probably are involved in cell fusion ( 4 ).

Some ADAM domains play critical and specific roles in protein localization ( 5 ), protease activity ( 6 - 7 ) as well as cell signaling ( 8 - 10 ) and regulation ( 11 - 13 ). Multiple functions are expected, especially in cellular process such as neuron differentiation ( 14 ), cell migration ( 15 - 16 ), cell determination ( 17 ), skin differentiation and hair cycling ( 18 ), cell-cell interactions ( 19 ) and membrane fusion ( 20 - 22 ). Several functional domains have been reported in ADAM.

ADAM genes are expressed in different tissues. A remarkable number of them are expressed in the male reproductive system and this expression bias increases the possible role of these proteins in reproduction ( 21 ). Several cell-cell and cell-matrix interactions participate in the spermatogenesis and fertilization processes. These interactions are essential for sperm maturation, sperm migration in uterus and oviduct, binding to cumulus cells, attachment to oocyte extracellular matrix (zona pellucida), binding to oocyte cell membrane and sperm-oocyte fusion. ADAM proteins play an important role in all these interactions ( 23 - 25 ).

Several methods have been applied to investigate the role of ADAM family proteins and their integrin partners in the process of reproduction. One study showed that monoclonal antibodies that work against the disintegrin domain of ADAM can reduce fertilization rates ( 26 ). The disintegrin domain is responsible for integrin receptor binding of ADAM. Monoclonal antibodies that act against oocyte integrin receptors have been recommended for inhibition of fertilization ( 27 ).

In addition to oocyte integrin receptors, monoclonal antibodies that act against integrin-related proteins such as CD9 and CD151 can partially inhibit oocyte-sperm fusion ( 28 ). The saturation of the oocyte receptors with ADAM mimic peptides can hinder oocyte-sperm binding and fusion ( 29 ). Furthermore, the functional domains of ADAM expressed in hosts such as E. coli can prevent sperm-oocyte binding and fusion ( 30 ). These processes provide valuable information about the fertilization process. However, owing to the expression of several similar ADAM isoforms in sperm and the multi-domain structure of these proteins, it is difficult to restrict experiments to a specific ADAM isoform or to investigate all the functions of a protein using such processes.

The use of mutant knockout mouse can make it possible to examine the effects of a specific isoform without disadvantages. In some cases, the mutation could cause infertility, while others have shown no significant difference in wild-type mice. For example, homozygote mutant mice for the ADAM1a gene are infertile because the sperm cannot migrate from the vagina to the oviduct ( 31 ); however, the knockout mouse mutated with in ADAM1b gene are fertile and it seems that this gene is not essential to the reproductive process ( 32 ). The sperm of the ADAM3 mutant knockout mouse are infertile because they lack the ability to interact with zona pellucida. After the removal of zona pellucida, the sperm were able to fertilize the zona-free oocytes ( 33 ).

2. Objective

ADAM27 gene knockout mouse mutated for the transmembrane domain previously have been produced and evaluated ( 34 ). The aim of the current study was to assess the effect of ADAM27 on reproduction. Another mutated allele belonging to exons 1, 2 and 3 from the ADAM27 gene was used to generate the ADAM27 knockout mouse. The mutant male mice were studied genetically and phenotypically to spot any abnormalities.

3. Materials and Methods

3.1. Mice

NMRI and C57BL/6J mice strains were obtained from Pasture Institute (Tehran, Iran). The mice were kept under the conditions of 50% humidity in a 14:10 h light: dark cycle. They were fed a standard pellet diet and tap water supplied as desired. All animal handling was conducted based on European guidelines (EU Directive 2010/63/EU).

3.2. Knockout Generation

3.2.1. Cells

The R1 mouse embryonic stem cells (mESCs) were used for knockout mouse production. The ADAM27 allele in these cells was inactivated by a genetic construct containing two homologous arms flanking a neomycin resistant gene cassette. In the mutant cells, a segment of the ADAM27 gene that includes the Kozak sequence, initiation codon, exons 1, 2 and 3, introns 1 and 2, and part of intron 3 were replaced with the neomycin gene (Fig. 1).

Figure 1. The mechanism of homologous recombination and the exons used in this study

The mESCs were co-cultured with mouse embryo fibroblast (MEF) cells in high glucose DMEM medium (Gibco; 884155) supplemented with 15% fetal bovine serum (FBS), 2 mm L-glutamine (Gibco; 073), 0.1 mm non-essential amino acids (Gibco; 11140), 0.1 mm 2-mercaptoethanol (Sigma; M7522), 50 U.mL^-1 penicillin-streptomycin (Sigma; M074) and 1000 U.mL^-1 leukemia inhibitory factor (Millipore; DAM1770435)) in a tri-gas incubator (5% CO₂, 5% O₂, 90% N₂) incubator at 37 °C and 95% humidity.

Additional essential supplements for the growth of the mESCs were provided by a monolayer of inactivated MEF feeder cells as described previously ( 35 ). Briefly, the MEFs were isolated from 12.5 dpc mouse embryos and grown in high glucose DMEM (Gibco; 884155) containing 10% FBS, 2 mm of L-glutamine (Gibco; 073), 0.1 mm of non-essential amino acids (Gibco; 11140) and 50 U.mL^-1 of penicillin-streptomycin (Sigma; M074)) in a tri-gas incubator (5% CO₂, 5% O₂, 90% N₂) incubator at 37 °C and 95% humidity. The MEFs were inactivated by mitomycin C (Sigma; M0503) treatment and were applied as the mESC feeder layer.

3.2.2. Blastocyst Injection

Chimeric mice were generated by blastocyst microinjection as described by Khezri et al. ( 36 ). In brief, ESC clones were turned into single cells by treatment with Trypsin-EDTA 0.05 and pipetting. The cells were washed with PBS and resuspended in M2 embryo culture media. They were kept at 10 °C until injection. Only 3.5 dpc, grade-A blastocysts were used. Eight to 16 single mutant cells were injected into the blastocoel cavity using a Narishige micromanipulator. The injected blastocysts then were cultured in M16 embryonic culture media in 37 °C, 5% CO₂, 5% N₂ and 90% air for 2-3 h.

3.2.3. Generation of ADAM27-/- Knockout Mouse

The injected blastocysts were transferred in groups of 7 to 12 to the uterus of 2.5 dpc recipient female mice (NMRI strain) by embryo transfer surgery as described by Hogan et al. ( 37 ). After birth, the chimeric pups could be identified by their eye and skin colors. Male agouti chimeric mice were mated with female C57BL/6J mice and the heterozygote pups were selected after polymerase chain reaction (PCR) testing for the ADAM27 mutated allele. The mature heterozygotes were mated for the production of knock-out homozygote ADAM27 mutant mice.

3.3. Knockout Confirmation

3.3.1. PCR Analysis

The pups resulting from ADAM27 heterozygote breeding were analyzed by PCR testing using ADAM27 wild and mutated allele primers. Primers for wild-type gene amplification (KOATGfp, AAGTGCAAGAAGCTCAGCCGA and KOATGrp, CCTGAGCTGGTAGTTCTGAAC) and for mutant gene amplification (KOATGfp, and NeoRI, AGGA GCAAGGTGAGATGACAG) were generated (Gen Fan Avaran, Iran) and optimized to a 50 °C annealing temperature. The cycling conditions comprised 4 min of heating at 95 °C and 35 cycles at 95 °C for 30 s, 50 °C for 30 s and 72 °C for 60 s.

3.3.2. Gene Sequencing

To confirm the deletion of the ADAM 27 gene, the mutant part of gene was sequenced using the knockout mouse gene.

3.4. Knockout Analysis

3.4.1. Breeding

Homozygote ADAM27 mutant male mice and wild-type control male mice were mated with C57BL/6J wild-type female mice to determine fertility. The mating rate, pregnancy rate and number of newborns were recorded and statistically analyzed.

3.4.2. In-vitro Fertilization

In-vitro fertilization was performed to evaluate the ability of the mutant sperm to fertilize the oocyte naturally as described by Sztein et al. ( 38 ). Briefly, the oocytes were isolated from the ampulla of superovulated NMRI female mice at 13 h after the hCG injection. Grade-A oocytes were selected and used for IVF. Mutant sperm (ADAM27^-/-) and wild-type sperm (as control) were used in the IVF procedure. The fertilization and blastocyst rates were recorded and analyzed.

3.4.3. Histological Examination

A mouse from each knockout and wild-type was sacrificed and necropsies were performed. Samples from the kidney, liver, heart, intestine, lung, brain and testis were taken for histopathological assessment. Also investigated were abnormalities in the process of maturation of the primary spermatocytes to spermatozoa in the testicular tissue to determine whether or not the mutation negatively affected spermatogenesis. The biopsy samples were preserved in 10% buffer formalin, then dehydrated and embedded in paraffin with a paraffin tissue processor (DS 2080/H; Did Sabz) and paraffin dispenser (DS 4LM; Did Sabz). The sections were prepared by cutting the paraffin blocks into 5 μm thicknesses (Rotary Microtome RM2145; Leica). They then were stained with hematoxylin-eosin and observed by light microscopy (E600; Nikon) ( 39 ).

3.4.4. Sperm Motility Analysis

Epididymal sperm from homozygote mutants and wild-type mice were evaluated for morphological and motility features using phase contrast microscopy (Nikon). The sperm motility was assessed by computer-assisted semen analysis (CASA) ( 39 ). The sperm samples were kept at 37 °C in HTF media for 1 h before CASA analysis. The following parameters were measured: total motility (%), progressive motility (%), distance average path (DAP; mm), distance curved line (DSL; mm), distance straight line (DSL; mm), velocity average path (VAP, mm/s), velocity curved line (VCL; mm/s), velocity straight line (VSL; mm/s), variation on straightness (STR), VSL/VAP (%), linearity (LIN), VSL/VCL (%), wobble (WOB), VAP/VCL (%), amplitude of lateral head displacement (ALH; mm), and beat cross frequency (BCF; Hz).

3.4.5. Histological Studies

The testicular tissues were biopsies from both ADAM27^-/- and normal mice and fixed in 10% formalin. The paraffin-embedded tissues were subjected for microtome dissection and histopathological studies.

3.4.6. Statistical Analyses

All data were statistically analyzed using SAS version 9.1 (SAS; USA). The data was tested for univariate normality and the mean values were subjected to t-tests.

4. Results

4.1. Generation of ADAM27-/- Knockout Mouse

The blastocyst microinjection of the ADAM27-mutant mESC was resulted in chimeric mouse, which was distinguished from wild-type mouse by the agouti-white color skin (Fig. 2). Mutant homozygote mice were used to investigate the role of ADAM27 protein in fertilization. We obtained heterozygote mice (ADAM27^+/-) by mating high-percentage chimeric male mice with C57BL/6J wild-type female mice and then mating the heterozygotes to gain mutated homozygotes.

Figure 2. Agouti and white chimeric mouse (Right) compared with a wild mouse which is completely white (Left)

The number of new born pups in different groups were summarized in Table 1.

4.2. Knockout Confirmation

4.2.1. Genetically Confirmation

We confirmed the genomic DNA of the heterozygote mice (ADAM27^+/-) and homozygote mutant mice (ADAM27^-/-) by PCR. The offspring of male chimeras also were evaluated by PCR. The PCR results confirmed that a number of pups were heterozygote for the ADAM27 gene. ADAM27 mutated homozygotes were also identified by PCR in the offspring of male and female heterozygotes (Fig. 3A).

Figure 3. The pups genotype analysis. A) The KOATGfp and KOATGrp primers amplified the natural allele and KOATGfp and NeoRI primers amplified the mutated allele. B) The result of gene sequencing of mutant part. The blue nucleotides are the remaining part of ADAM27 gene and the red nucleotides are beginning part of neomycin resistant gene.

The results of gene sequencing show that the exons 1, 2, and 3 of the ADAM 27 gene were replaced by the neomycin resistant gene in the genome (Fig. 3B). This figure shows that a part of ADAM 27 gene was replaced by neomycin resistant gene.

4.3. Knockout Analysis

4.3.1. Breeding

The heterozygote male mice (ADAM27^+/-) were mated with wild-type female mice (ADAM27^+/+). They showed normal fertilization rates and there was no significant decrease in the number of newborn in the ADAM27^+/- group compared with the wild-type group. The average number of newborns was 8.5 for the ADAM27^+/- group and 9.1 for the wild-type group.

In order to investigate the fertility rate of the homozygote mutant mice (ADAM27^-/-), the male ADAM27^-/- mice were mated with normal females (ADAM27^+/+) and the results were compared with the wild-type male group. The average number of newborns was statistically similar in both groups. The average number of newborns was 8.9 for the ADAM27^-/- group and 9.1 for the wild-type group. The male and female ADAM27^-/- mice showed normal behavior and were similar in weight, size and longevity compared to the wild-type male and female mice.

4.3.2. In Vitro Fertilization

In-vitro fertilization was carried out to compare the rates of fertilization by homozygote mutant sperm and wild-type sperm. A total of 327 oocytes were incubated with ADAM27^-/- sperm and 172 embryos were obtained (52%). A total of 289 oocytes were incubated with ADAM27^+/+ sperm and 156 embryos (54%) were obtained. There was no significant difference in the rate of fertilization between the ADAM27 homozygote mutant and wild-type groups (Fig. 4).

Figure 4.In Vitro Fertilization rate of sperm in two groups. Gray columns represent the number of oocytes used for IVF and black columns shows the successful zygotes.

4.3.3. Pathology

4.3.3.1. Sperm Motility

The epididymis sperm of the ADAM27^-/- mice were analyzed morphologically and compared with the sperm of ADAM27^+/+ mice. There was no remarkable difference in the shape, size and motility of the two types of sperm. Moreover, the ADAM27^-/- mice sperm concentration showed no decrease compared to the wild-type mice (Fig. 5).

Figure 5.A) Viability, B) sperm kinetic, C) motility and D) progressive motility of knock-out (KNO) and normal sperms

4.3.3.2. Histopathology

The histopathological sample from the examined organ was normal (Fig. 6).

Figure 6. Histopathology results of testis of normal and ADAM27^-/- mice. A) Image of normal mouse testis, B) testis of ADAM27^-/-. Spermatogonia, spermatocytes and spermatozoa and the basement membrane were indicated with arrows.

5. Discussion

The ADAM27 gene is expressed exclusively in testis tissue. Although transcription of this gene begins from day 15 after birth, the ADAM27 protein is inactive in spermatogonial stem cells and even in testicular sperm. In the epididymis, ADAM27 is activated by detaching the prodomain ( 40 ). Testis-specific expression of ADAM27 raises questions about the role of this protein in testis development, spermatogenesis and fertilization.

ADAM27^-/- knock-out mice were produced to investigate the role of ADAM27 in reproduction. The male ADAM27^-/- mice then were mated with female wild-type mice. These mutant mice showed normal reproductive behavior and the number of newborns was similar to that of wild-type mice. The testis histopathology demonstrated normal morphology and the CASA results for both the ADAM27^-/- and wild-type sperms indicated similar behavior and features.

The ADAM27 gene shows the most similarity to the ADAM3 gene ( 40 ); however, knock-out mice with the ADAM3 gene are infertile as their sperm are unable to bind to the zona pellucida of oocytes ( 33 ). Accordingly, it was assumed that the ADAM27 protein could play a role in binding to oocyte envelopes. Although the knock-out mice exhibited natural fertility, the mutant sperm appeared to require more time for binding and crossing the oocyte envelope than the wild-type sperm. Thus, IVF was conducted to investigate the ability of homozygote mutant sperm (ADAM27^-/-) to bind and pass through the oocyte envelope.

The fertilization rate in mutant and wild-type groups was similar and there was no significant difference between the two groups. This suggests that the deletion of this gene neither prevented fertilization nor significantly affected the fertilization rate.

Several ADAM genes (at least 18) are expressed in the reproductive tracts of male mice ( 41 ). Because the structure and function of ADAM genes are identical, it is possible that other ADAM genes compensated for the absence of the ADAM27 gene. The ADAM27 homozygote mutant sperm was able to maintain their fertilization ability and showed a normal phenotype.

Normal reproduction has been reported in mutant mice having different ADAM family members ( 32 ) or incapacitated receptors ( 42 ). These mutant mice had a normal fertilization phenotype ( 32 , 43 ). These findings have been reported in other studies examining a member of this family expressed exclusively in the reproduction system. However, mutations in other members of the ADAM family have been shown to reduce the fertilization rate or even cause infertility ( 31 , 33 ). These findings show that not all ADAM genes expressed in the mice reproduction system are essential for fertilization. Although some, such as ADAM2, ADAM7 and ADAM24, play a key role in normal reproductive system development and fertilization, the presence of others is not critical for normal fertilization ( 44 ).

These results pose the questions of whether or not the expression of some ADAM genes in the reproduction system is essential for fertilization and why do they remain in the genome and continue to be expressed in the male reproductive system. Studies have increased the number of testis-specific ADAM genes after several rounds of duplication and positive selection ( 45 - 46 ). Fertilization may be possible only with some isoforms of the ADAM genes, but sperm expressing more ADAMs tend to be more fertile than other sperm types, which provides them more opportunities to participate in the next generation’s gene pool.

In addition to the need for interaction with different environments, envelopes and cells (critical ADAMs), sperm competition may provide a force through redundant reproduction of ADAM genes in the male rodent reproduction system to keep these genes in the genome (redundant ADAMs). Although some ADAM genes expressed in the testes do not play a critical role in fertilization and reproduction, they appear to increase the ability of the sperm to fertilize the oocyte when competing with sperm that lack these genes.

Although a mutation in one or some genes involved in the phenotype might not disrupt the fertilization process, mutant sperm fertilization ability could decrease compared with that of the wild-type sperm. If the decrease in fertilization ability is low, more effective methods are required to determine the precise effects. In some cases, the observation of a gene effect could require the organism to be exposed to a condition other than standard laboratory conditions.

6. Conclusion

The fertilization ability of sperm is a polygenic phenotype. Like several similar studies, we could not observe a significant effect on the normal reproductive ability of mutant mice in a reproductive ADAM gene. ADAM27 is not essential for reproduction in mice. Considering the expression of several other isoforms of the ADAM family in sperm, the role of this gene is probably covered and compensated by other isoforms. ADAM genes play a role in some signaling pathways and some exhibit proteolytic activity, which could be considered in future investigations. Knock-out line generation from different ADAM genes could pave the way for planning more experiments on the process of fertilization. Planning and implementing such investigations would help us to better understand the fertilization process, as well as the proteins involved and their roles.

References

1. Eto K, Huet C, Tarui T, Kupriyanov S, Liu HZ, Puzon-McLaughlin W, Zhang XP, Sheppard D, Engvall E, Takada Y. Functional classification of ADAMs based on a conserved motif for binding to integrin α9β1: implications for sperm-egg binding and other cell interactions.  J Biol Chem.  2002; 277(20):17804-17810.
2. Martinez-Rico C, Pincet F, Thiery JP, Dufour S. Integrins stimulate E-cadherin-mediated intercellular adhesion by regulating Src-kinase activation and actomyosin contractility.  J Biol Chem. 2010; 123(5):712-722.
3. Seals DF, Courtneidge SA. The ADAMs family of metalloproteases: multidomain proteins with multiple functions.  Genes Deve. 2003; 17(1):7-30.
4. Blobel CP, Wolfsberg TG, Turck CW, Myles DG, Primakoff P, White JM. A potential fusion peptide and an integrin ligand domain in a protein active in sperm–egg fusion.  Nature.  1992 ; 356(6366):248-252.
5. Edwards DR, Handsley MM, Pennington C J. The ADAM metalloproteinases.  Mol Aspects Med. 2008; 29(5):258-289.
6. Primakoff P, Myles DG. The ADAM gene family: surface proteins with adhesion and protease activity.  Trends Gene.  2000; 16(2):83-87. DOI
7. Duffy MJ, Mullooly M, O’Donovan N, Sukor S, Crown J, Pierce A, McGowan PM. The ADAMs family of proteases: new biomarkers and therapeutic targets for cancer?.  Clin proteomics.  2011; 8(1):1-13. DOI
8. Zhong JL, Poghosyan Z, Pennington CJ, Scott X, Handsley MM, Warn A, Gavrilovic J, Honert K, Kruger A, Span PN, Sweep FCGJ, Edwards DR. Distinct functions of natural ADAM-15 cytoplasmic domain variants in human mammary carcinoma.  Mole Cancer Res. 2008; 6(3):383-394. DOI
9. Saha N, Robev D, Himanen JP, Nikolov DB. ADAM proteases: emerging role and targeting of the non-catalytic domains.  Cancer Lett. 2019; 467:50-57.
10. Saad MI, Alhayyani S, McLeod L, Yu L, Alanazi M, Deswaerte V, Tang K, Jarde T, et al. ADAM 17 selectively activates the IL-6 trans-signaling/ERK MAPK axis in KRAS-addicted lung cancer.  EMBO Mol Med. 2019; 11(4):e9976.
11. Latefi NS, Pedraza L, Schohl A, Li Z, Ruthazer ES. N=cadherin prodomain cleavage regulates synapse formation in vivo. Dev Neuro Biol. 2009; 69(8):518-529. DOI
12. Smith KM, Gaultier A, Cousin H, Alfandari D, White JM, DeSimone DW. The cysteine-rich domain regulates ADAM protease function in vivo. J Cell Biol. 2002; 159(5):893-902. DOI
13. Dutta I, Dieters-Castator D, Papatzimas JW, Medina A, Schueler J, Derksen DJ, Lajoie G, Ppstovit LM, Siegers G. M.. ADAM protease inhibition overcomes resistance of breast cancer stem-like cells to γδ T cell immunotherapy. Cancer Lett.  2021; 496:156-168. DOI
14. Markus-Koch A, Schmitt O, Seemann S, Lukas J, Koczan D, Ernst M, Fuellen G, Wree A, Rolfs A, Luo J. ADAM23 promotes neuronal differentiation of human neural progenitor cells.  Cell Mol Biol Lett. 2017; 22(1):1-13. DOI
15. Dreymueller D, Theodorou K, Donners M, Ludwig A. Fine tuning cell migration by a disintegrin and metalloproteinases.  Mediators Inflamm. 2017. DOI
16. Lu HY, Chu HX, Tan YX, Qin XC, Liu MY, Li JD, Ren TS, Zhang YS, Zhao QC. Novel ADAM-17 inhibitor ZLDI-8 inhibits the metastasis of hepatocellular carcinoma by reversing epithelial-mesenchymal transition in vitro and in vivo.  Life Sci. 2002; 244:117343. DOI
17. Lin J, Yan X, Wang C, Talabattula VAN, Guo Z, Rolfs A, Luo J. Expression patterns of the ADAM s in early developing chicken cochlea.  Dev Growth Differ. 2013; 55(3):368-376. DOI
18. Oh ST, Cho BK, Schramme A, Gutwein P, Tilgen W, Reichrath J. Hair-cycle dependent differential expression of ADAM 10 and ADAM 12: an immunohistochemical analysis in human hair follicles in situ.  Derm-Endocrinol. 2009; 1(1):46-53. DOI
19. Zigrino P, Nischt R, Mauch C. The disintegrin-like and cysteine-rich domains of ADAM-9 mediate interactions between melanoma cells and fibroblasts.  J Biol Chem. 2011; 286(8):6801-6807. DOI
20. Huovila APJ, Almeida EA, White J M. ADAMs and cell fusion.  Curr Opin Cell Biol. 1996; 8(5):692-699. DOI
21. Cho C. Testicular and epididymal ADAMs: expression and function during fertilization.  Nat Rev Urol. 2012; 9(10):550-560. DOI
22. Souza JSM, Lisboa ABP, Santos TM, Andrade MVS, Neves VBS, Teles-Souza J, Jesus HNR. The evolution of ADAM gene family in eukaryotes.  Genomics. 2020; 112(5):3108-3116. DOI
23. Inoue N, Ikawa M, Okabe M. The mechanism of sperm–egg interaction and the involvement of IZUMO1 in fusion.  Asian J Androl. 2011; 13(1):81. DOI
24. Talbot P, Shur BD, Myles DG. Cell adhesion and fertilization: steps in oocyte transport, sperm-zona pellucida interactions, and sperm-egg fusion. Biol Reprod. 2003; 68(1):1-9. DOI
25. Yuan R, Primakoff P, Myles DG. A role for the disintegrin domain of cyritestin, a sperm surface protein belonging to the ADAM family, in mouse sperm–egg plasma membrane adhesion and fusion. J Cell Biol. 1997; 137(1):105-112. DOI
26. Suri A. Sperm specific proteins-potential candidate molecules for fertility control. Reproductive Biology and Endocrinology. 2004; 2(1):1-6. DOI
27. Chen MS, Almeida EAC, Huovila AP, Takahashi Y, Shaw LM, Mercurio AM, White JM. Evidence that distinct states of the integrin α6β1 interact with laminin and an ADAM.  J Cell Biol. 2009; 144(3):549-561. DOI
28. Ziyyat A, Rubinstein E, Monier-Gavelle F, Barraud V, Kulski O, Prenant M, Boucheix C, Bomsel M, Wolf JP. CD9 controls the formation of clusters that contain tetraspanins and the integrin α6β1, which are involved in human and mouse gamete fusion.  J Cell Sci. 2006; 119(3):416-424. DOI
29. McLaughlin EA, Frayne J, Bloomerg G, Hall L. Do fertilin β and cyritestin play a major role in mammalian sperm-oolemma interactions? A critical re-evaluation of the use of peptide mimics in identifying specific oocyte recognition proteins. Mol Hum Reprod. 2001; 7(4):313-317. DOI
30. Takahashi Y, Bigler D, Ito Y, White JM. Sequence-specific interaction between the disintegrin domain of mouse ADAM 3 and murine eggs: role of β1 integrin-associated proteins CD9, CD81, and CD98. Mol Biol Cell. 2001; 12(4):809-820. DOI
31. Nishimura H, Kim E, Nakanishi T, Baba T. Possible function of the ADAM1a/ADAM2 Fertilin complex in the appearance of ADAM3 on the sperm surface. J Biol Chem. 2004; 279(33): 34957-34962. DOI
32. Kim E, Yamashita M, Nakanishi T, Park KE, Kimura M, Kashiwabara SI, Baba T. Mouse sperm lacking ADAM1b/ADAM2 fertilin can fuse with the egg plasma membrane and effect fertilization. J Biol Chem. 2006; 281(9):5634-5639. DOI
33. Shamsadin R, Adham IM, Nayernia K, Heinlein UA, Oberwinkler H, Engel W. Male mice deficient for germ-cell cyritestin are infertile.  Biol Reprod. 1999; 61(6):1445-1451. DOI
34. Bolcun-Filas E. Expression and functional analysis of the germ cell specific genes ADAM 27 and Testase 2 (Doctoral dissertation, Niedersächsische Staats-und Universitätsbibliothek Göttingen). ‏ 2004.
35. Jozefczuk J, Drews K, Adjaye J. Preparation of mouse embryonic fibroblast cells suitable for culturing human embryonic and induced pluripotent stem cells.  J Vis Exp. 2012; 21(64):3854. DOI
36. Khezri J, Heidari F, Shamsara M. A Study on Merits and Demerits of Two Main Gene Silencing Techniques in Mice. Iran J Biotechnol. 2018; 16(3):e1632. DOI
37. Hogan B, Costantini F, Lacy E. Manipulating the mouse embryo: a laboratory manual. ‏ 1986.
38. Sztein JM, Farley JS, Mobraaten LE. In vitro fertilization with cryopreserved inbred mouse sperm.  Biol Reprod.  2000; 63(6):1774-1780. DOI
39. Betancourt M, Reséndiz A. Effect of two insecticides and two herbicides on the porcine sperm motility patterns using computer-assisted semen analysis (CASA) in vitro. Reprod Toxicol. 2006; 22(3):508-512. DOI
40. Kim T, Oh J, Woo JM, Choi E, Im SH, Yoo YJ, Kim DH, Nishimura H, Cho C. Expression and relationship of male reproductive ADAMs in mouse.  Biol Reprod. 2006; 74(4):744-750. DOI
41. Han C, Choi E, Park I, Lee B, Jin S, Kim DH, Nishimura H, Cho C. Comprehensive analysis of reproductive ADAMs: relationship of ADAM4 and ADAM6 with an ADAM complex required for fertilization in mice. Biol Reprod. 2009; 80(5):1001-1008. DOI
42. He ZY, Brakebusch C, Fässler R, Kreidberg JA, Primakoff P, Myles DG. None of the integrins known to be present on the mouse egg or to be ADAM receptors are essential for sperm–egg binding and fusion.  Dev Biol. 2003; 254(2):226-237. DOI
43. Lee S, Hong SH, Cho C. Normal fertility in male mice lacking ADAM32 with testis-specific expression.  Reproductive Biology. 2020; 20(4):589-594. DOI
44. Holcomb RJ, Oura S, Nozawa K, Kent K, Yu Z, Robertson MJ, Coarfa C, Matzuk MM, Garcia TX. The testis-specific serine proteases PRSS44, PRSS46, and PRSS54 are dispensable for male mouse fertility.  Biol Reprod. 2020; 102(1):84-91. DOI
45. Grayson P, Civetta A. Positive selection in the adhesion domain of Mus sperm Adam genes through gene duplications and function-driven gene complex formations.  BMC Evol Biol.  2013; 13(1): 1-8. DOI
46. Long J, Li M, Ren Q, Zhang C, Fan J, Duan Y, Chen J, Li B, Deng L. Phylogenetic and molecular evolution of the ADAM (a disintegrin and metalloprotease) gene family from xenopus tropicalis, to Mus musculus, rattus norvegicus, and homo sapiens.  Gene. 2012; 507(1):36-43. DOI